\
| Variant ID: vg1000994273 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 994273 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.01, others allele: 0.00, population size: 82. )
ACAAAAATTACTCTCAATCTGAAGTTTCTCGTCACTTTTTGAATGGTCTTGACATGTCTATTTGGGAGATGAAATTTACATCAATTCAGGAGTCTGTCGA[T/A]
ATGTCTACTTTGATTTTGGATTCACTTTACACAAAACTGAAAACACATGAGATGAATATTCTTTCTCGTAAAATTGATTCTAATTCTAGTGCTTTGGTTT
AAACCAAAGCACTAGAATTAGAATCAATTTTACGAGAAAGAATATTCATCTCATGTGTTTTCAGTTTTGTGTAAAGTGAATCCAAAATCAAAGTAGACAT[A/T]
TCGACAGACTCCTGAATTGATGTAAATTTCATCTCCCAAATAGACATGTCAAGACCATTCAAAAAGTGACGAGAAACTTCAGATTGAGAGTAATTTTTGT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 33.30% | 4.00% | 9.73% | 52.94% | NA |
| All Indica | 2759 | 2.60% | 6.80% | 15.48% | 75.06% | NA |
| All Japonica | 1512 | 89.90% | 0.00% | 0.60% | 9.52% | NA |
| Aus | 269 | 3.30% | 0.00% | 4.46% | 92.19% | NA |
| Indica I | 595 | 1.80% | 7.20% | 11.60% | 79.33% | NA |
| Indica II | 465 | 2.60% | 6.70% | 6.67% | 84.09% | NA |
| Indica III | 913 | 1.90% | 3.90% | 19.72% | 74.48% | NA |
| Indica Intermediate | 786 | 4.20% | 9.90% | 18.70% | 67.18% | NA |
| Temperate Japonica | 767 | 97.50% | 0.00% | 0.65% | 1.83% | NA |
| Tropical Japonica | 504 | 82.30% | 0.00% | 0.00% | 17.66% | NA |
| Japonica Intermediate | 241 | 81.30% | 0.00% | 1.66% | 17.01% | NA |
| VI/Aromatic | 96 | 88.50% | 0.00% | 7.29% | 4.17% | NA |
| Intermediate | 90 | 54.40% | 1.10% | 5.56% | 38.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1000994273 | T -> A | LOC_Os10g02600.1 | missense_variant ; p.Asp262Glu; MODERATE | nonsynonymous_codon ; D262K | Average:14.443; most accessible tissue: Callus, score: 45.27 | benign |
0.381 |
DELETERIOUS | 0.01 |
| vg1000994273 | T -> A | LOC_Os10g02600.1 | missense_variant ; p.Asp262Glu; MODERATE | nonsynonymous_codon ; D262E | Average:14.443; most accessible tissue: Callus, score: 45.27 | benign |
1.117 |
DELETERIOUS | 0.01 |
| vg1000994273 | T -> DEL | LOC_Os10g02600.1 | N | frameshift_variant | Average:14.443; most accessible tissue: Callus, score: 45.27 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1000994273 | NA | 1.31E-12 | mr1326 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000994273 | NA | 1.24E-26 | mr1686 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000994273 | NA | 8.48E-07 | mr1690 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000994273 | NA | 1.12E-14 | mr1162_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000994273 | NA | 7.05E-06 | mr1519_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000994273 | NA | 4.77E-10 | mr1595_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000994273 | NA | 1.64E-07 | mr1698_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000994273 | NA | 2.36E-07 | mr1748_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000994273 | NA | 8.83E-11 | mr1756_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |