\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1000994273:

Variant ID: vg1000994273 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 994273
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.01, others allele: 0.00, population size: 82. )

Flanking Sequence (100 bp) in Reference Genome:


ACAAAAATTACTCTCAATCTGAAGTTTCTCGTCACTTTTTGAATGGTCTTGACATGTCTATTTGGGAGATGAAATTTACATCAATTCAGGAGTCTGTCGA[T/A]
ATGTCTACTTTGATTTTGGATTCACTTTACACAAAACTGAAAACACATGAGATGAATATTCTTTCTCGTAAAATTGATTCTAATTCTAGTGCTTTGGTTT

Reverse complement sequence

AAACCAAAGCACTAGAATTAGAATCAATTTTACGAGAAAGAATATTCATCTCATGTGTTTTCAGTTTTGTGTAAAGTGAATCCAAAATCAAAGTAGACAT[A/T]
TCGACAGACTCCTGAATTGATGTAAATTTCATCTCCCAAATAGACATGTCAAGACCATTCAAAAAGTGACGAGAAACTTCAGATTGAGAGTAATTTTTGT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 33.30% 4.00% 9.73% 52.94% NA
All Indica  2759 2.60% 6.80% 15.48% 75.06% NA
All Japonica  1512 89.90% 0.00% 0.60% 9.52% NA
Aus  269 3.30% 0.00% 4.46% 92.19% NA
Indica I  595 1.80% 7.20% 11.60% 79.33% NA
Indica II  465 2.60% 6.70% 6.67% 84.09% NA
Indica III  913 1.90% 3.90% 19.72% 74.48% NA
Indica Intermediate  786 4.20% 9.90% 18.70% 67.18% NA
Temperate Japonica  767 97.50% 0.00% 0.65% 1.83% NA
Tropical Japonica  504 82.30% 0.00% 0.00% 17.66% NA
Japonica Intermediate  241 81.30% 0.00% 1.66% 17.01% NA
VI/Aromatic  96 88.50% 0.00% 7.29% 4.17% NA
Intermediate  90 54.40% 1.10% 5.56% 38.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1000994273 T -> A LOC_Os10g02600.1 missense_variant ; p.Asp262Glu; MODERATE nonsynonymous_codon ; D262K Average:14.443; most accessible tissue: Callus, score: 45.27 benign 0.381 DELETERIOUS 0.01
vg1000994273 T -> A LOC_Os10g02600.1 missense_variant ; p.Asp262Glu; MODERATE nonsynonymous_codon ; D262E Average:14.443; most accessible tissue: Callus, score: 45.27 benign 1.117 DELETERIOUS 0.01
vg1000994273 T -> DEL LOC_Os10g02600.1 N frameshift_variant Average:14.443; most accessible tissue: Callus, score: 45.27 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1000994273 NA 1.31E-12 mr1326 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000994273 NA 1.24E-26 mr1686 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000994273 NA 8.48E-07 mr1690 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000994273 NA 1.12E-14 mr1162_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000994273 NA 7.05E-06 mr1519_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000994273 NA 4.77E-10 mr1595_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000994273 NA 1.64E-07 mr1698_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000994273 NA 2.36E-07 mr1748_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000994273 NA 8.83E-11 mr1756_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251