Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1000990951:

Variant ID: vg1000990951 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 990951
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.95, G: 0.05, others allele: 0.00, population size: 86. )

Flanking Sequence (100 bp) in Reference Genome:

ACACCGCATATACTATATATTGGTATCAAGTCACTTGGTTGACTATAATTATCAAAAACCACTCAGTTGGTTGGATTATTTATTCCCTGACTATATGCTT[A/G]
GTTTATTCAATTAACCCCATAGTCGGGAGCTACACCTATTAGGTGCATCTAGTCGATGCACCTAAGTTTACATTCAGTTATTTTTCAGCCCTCCACAGTC

Reverse complement sequence

GACTGTGGAGGGCTGAAAAATAACTGAATGTAAACTTAGGTGCATCGACTAGATGCACCTAATAGGTGTAGCTCCCGACTATGGGGTTAATTGAATAAAC[T/C]
AAGCATATAGTCAGGGAATAAATAATCCAACCAACTGAGTGGTTTTTGATAATTATAGTCAACCAAGTGACTTGATACCAATATATAGTATATGCGGTGT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	33.40%	0.40%	12.34%	53.89%	NA
All Indica	2759	2.70%	0.70%	19.83%	76.77%	NA
All Japonica	1512	89.80%	0.00%	0.53%	9.66%	NA
Aus	269	3.30%	0.00%	7.43%	89.22%	NA
Indica I	595	2.00%	1.00%	18.99%	77.98%	NA
Indica II	465	2.80%	0.00%	26.67%	70.54%	NA
Indica III	913	1.50%	0.90%	13.91%	83.68%	NA
Indica Intermediate	786	4.60%	0.60%	23.28%	71.50%	NA
Temperate Japonica	767	97.40%	0.00%	0.39%	2.22%	NA
Tropical Japonica	504	82.30%	0.00%	0.40%	17.26%	NA
Japonica Intermediate	241	81.30%	0.00%	1.24%	17.43%	NA
VI/Aromatic	96	88.50%	0.00%	1.04%	10.42%	NA
Intermediate	90	55.60%	0.00%	7.78%	36.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1000990951	A -> G	LOC_Os10g02600.1	upstream_gene_variant ; 1696.0bp to feature; MODIFIER	silent_mutation	Average:10.482; most accessible tissue: Minghui63 panicle, score: 20.733	N	N	N	N
vg1000990951	A -> G	LOC_Os10g02584-LOC_Os10g02600	intergenic_region ; MODIFIER	silent_mutation	Average:10.482; most accessible tissue: Minghui63 panicle, score: 20.733	N	N	N	N
vg1000990951	A -> DEL	N	N	silent_mutation	Average:10.482; most accessible tissue: Minghui63 panicle, score: 20.733	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1000990951	NA	2.36E-21	mr1698	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000990951	2.66E-06	NA	mr1926	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000990951	NA	9.16E-15	mr1162_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000990951	NA	4.52E-08	mr1299_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000990951	NA	1.76E-19	mr1657_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000990951	NA	1.78E-21	mr1698_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000990951	4.91E-06	1.38E-08	mr1698_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000990951	NA	4.13E-10	mr1756_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000990951	2.66E-06	5.03E-06	mr1994_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251