\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1000973578:

Variant ID: vg1000973578 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 973578
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GAACGGGAAGAATCTGAGTTTATATCATCTTCCAGAGCATTGAAATCAGATTCAGTAATTTTGCTGCCAGGGATAAGGATTTTTTATATACCTGCCAACT[T/C]
CTTCAGCCTTTTAGCCGATTTTCCCCTTTGTTTGCCAATTCCCATTCGATGATCAAATTTGAGCTCTTGGTTGGCATTAAGAAGCCTAGAGCTCTACCTT

Reverse complement sequence

AAGGTAGAGCTCTAGGCTTCTTAATGCCAACCAAGAGCTCAAATTTGATCATCGAATGGGAATTGGCAAACAAAGGGGAAAATCGGCTAAAAGGCTGAAG[A/G]
AGTTGGCAGGTATATAAAAAATCCTTATCCCTGGCAGCAAAATTACTGAATCTGATTTCAATGCTCTGGAAGATGATATAAACTCAGATTCTTCCCGTTC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 93.50% 2.30% 4.23% 0.00% NA
All Indica  2759 99.70% 0.10% 0.18% 0.00% NA
All Japonica  1512 80.80% 6.70% 12.50% 0.00% NA
Aus  269 99.30% 0.40% 0.37% 0.00% NA
Indica I  595 99.30% 0.20% 0.50% 0.00% NA
Indica II  465 99.40% 0.40% 0.22% 0.00% NA
Indica III  913 99.90% 0.00% 0.11% 0.00% NA
Indica Intermediate  786 99.90% 0.10% 0.00% 0.00% NA
Temperate Japonica  767 66.80% 12.60% 20.60% 0.00% NA
Tropical Japonica  504 97.60% 0.00% 2.38% 0.00% NA
Japonica Intermediate  241 90.50% 1.70% 7.88% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 91.10% 3.30% 5.56% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1000973578 T -> C LOC_Os10g02560.1 upstream_gene_variant ; 4480.0bp to feature; MODIFIER silent_mutation Average:74.249; most accessible tissue: Minghui63 young leaf, score: 85.236 N N N N
vg1000973578 T -> C LOC_Os10g02570.1 upstream_gene_variant ; 1625.0bp to feature; MODIFIER silent_mutation Average:74.249; most accessible tissue: Minghui63 young leaf, score: 85.236 N N N N
vg1000973578 T -> C LOC_Os10g02584.1 downstream_gene_variant ; 2873.0bp to feature; MODIFIER silent_mutation Average:74.249; most accessible tissue: Minghui63 young leaf, score: 85.236 N N N N
vg1000973578 T -> C LOC_Os10g02584.3 downstream_gene_variant ; 2873.0bp to feature; MODIFIER silent_mutation Average:74.249; most accessible tissue: Minghui63 young leaf, score: 85.236 N N N N
vg1000973578 T -> C LOC_Os10g02584.2 downstream_gene_variant ; 2873.0bp to feature; MODIFIER silent_mutation Average:74.249; most accessible tissue: Minghui63 young leaf, score: 85.236 N N N N
vg1000973578 T -> C LOC_Os10g02570-LOC_Os10g02584 intergenic_region ; MODIFIER silent_mutation Average:74.249; most accessible tissue: Minghui63 young leaf, score: 85.236 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1000973578 3.59E-06 NA mr1310_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000973578 5.25E-06 3.32E-07 mr1959_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251