\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1000961132:

Variant ID: vg1000961132 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 961132
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.69, G: 0.31, others allele: 0.00, population size: 74. )

Flanking Sequence (100 bp) in Reference Genome:


CAAGTGAATTCGGCTAAGATCATCAATAAGTACCAAAAGAAGTACGATAGACAACAGGAGAAGCGCTACGAGAAAGATGATGATGGCTTCGATCCTCATT[A/G]
GAGTTGTGAGTTCTTTAGATTCTGTTGGAATGAAGGTATGAGGCTGCCATCTATTGAAGACTGTCCTGAATGCGGCAACGTTGCAGAGAGTTCAAGCCAG

Reverse complement sequence

CTGGCTTGAACTCTCTGCAACGTTGCCGCATTCAGGACAGTCTTCAATAGATGGCAGCCTCATACCTTCATTCCAACAGAATCTAAAGAACTCACAACTC[T/C]
AATGAGGATCGAAGCCATCATCATCTTTCTCGTAGCGCTTCTCCTGTTGTCTATCGTACTTCTTTTGGTACTTATTGATGATCTTAGCCGAATTCACTTG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 34.80% 1.30% 2.07% 61.87% NA
All Indica  2759 4.60% 2.10% 3.12% 90.11% NA
All Japonica  1512 90.20% 0.00% 0.33% 9.46% NA
Aus  269 5.20% 0.00% 1.86% 92.94% NA
Indica I  595 6.40% 0.00% 2.18% 91.43% NA
Indica II  465 4.90% 10.10% 4.30% 80.65% NA
Indica III  913 2.60% 0.20% 2.41% 94.74% NA
Indica Intermediate  786 5.50% 1.30% 3.94% 89.31% NA
Temperate Japonica  767 98.00% 0.00% 0.00% 1.96% NA
Tropical Japonica  504 82.30% 0.00% 0.40% 17.26% NA
Japonica Intermediate  241 81.70% 0.00% 1.24% 17.01% NA
VI/Aromatic  96 89.60% 0.00% 1.04% 9.38% NA
Intermediate  90 56.70% 2.20% 1.11% 40.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1000961132 A -> G LOC_Os10g02530.1 upstream_gene_variant ; 1175.0bp to feature; MODIFIER silent_mutation Average:8.066; most accessible tissue: Callus, score: 26.098 N N N N
vg1000961132 A -> G LOC_Os10g02560.1 downstream_gene_variant ; 4763.0bp to feature; MODIFIER silent_mutation Average:8.066; most accessible tissue: Callus, score: 26.098 N N N N
vg1000961132 A -> G LOC_Os10g02544.1 intron_variant ; MODIFIER silent_mutation Average:8.066; most accessible tissue: Callus, score: 26.098 N N N N
vg1000961132 A -> DEL N N silent_mutation Average:8.066; most accessible tissue: Callus, score: 26.098 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1000961132 NA 2.65E-06 mr1184_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000961132 7.14E-06 3.37E-07 mr1245_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000961132 NA 1.02E-06 mr1278_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000961132 NA 9.45E-06 mr1321_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000961132 NA 3.74E-11 mr1322_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000961132 NA 2.09E-12 mr1325_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000961132 NA 3.23E-06 mr1329_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000961132 NA 6.30E-13 mr1330_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000961132 NA 1.36E-12 mr1338_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000961132 NA 2.53E-06 mr1338_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000961132 NA 1.09E-06 mr1346_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000961132 NA 3.05E-06 mr1360_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000961132 NA 9.09E-07 mr1360_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000961132 NA 5.24E-08 mr1373_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000961132 NA 7.38E-06 mr1373_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000961132 NA 1.05E-06 mr1428_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000961132 NA 9.51E-11 mr1449_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000961132 NA 1.35E-06 mr1497_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000961132 NA 1.31E-06 mr1508_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000961132 NA 7.77E-06 mr1524_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000961132 NA 1.31E-07 mr1527_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000961132 NA 2.46E-06 mr1648_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000961132 NA 1.30E-10 mr1690_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000961132 NA 1.62E-09 mr1715_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000961132 NA 4.16E-06 mr1779_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000961132 NA 9.82E-06 mr1992_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251