Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1000961132:

Variant ID: vg1000961132 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 961132
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.69, G: 0.31, others allele: 0.00, population size: 74. )

Flanking Sequence (100 bp) in Reference Genome:

CAAGTGAATTCGGCTAAGATCATCAATAAGTACCAAAAGAAGTACGATAGACAACAGGAGAAGCGCTACGAGAAAGATGATGATGGCTTCGATCCTCATT[A/G]
GAGTTGTGAGTTCTTTAGATTCTGTTGGAATGAAGGTATGAGGCTGCCATCTATTGAAGACTGTCCTGAATGCGGCAACGTTGCAGAGAGTTCAAGCCAG

Reverse complement sequence

CTGGCTTGAACTCTCTGCAACGTTGCCGCATTCAGGACAGTCTTCAATAGATGGCAGCCTCATACCTTCATTCCAACAGAATCTAAAGAACTCACAACTC[T/C]
AATGAGGATCGAAGCCATCATCATCTTTCTCGTAGCGCTTCTCCTGTTGTCTATCGTACTTCTTTTGGTACTTATTGATGATCTTAGCCGAATTCACTTG

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	34.80%	1.30%	2.07%	61.87%	NA
All Indica	2759	4.60%	2.10%	3.12%	90.11%	NA
All Japonica	1512	90.20%	0.00%	0.33%	9.46%	NA
Aus	269	5.20%	0.00%	1.86%	92.94%	NA
Indica I	595	6.40%	0.00%	2.18%	91.43%	NA
Indica II	465	4.90%	10.10%	4.30%	80.65%	NA
Indica III	913	2.60%	0.20%	2.41%	94.74%	NA
Indica Intermediate	786	5.50%	1.30%	3.94%	89.31%	NA
Temperate Japonica	767	98.00%	0.00%	0.00%	1.96%	NA
Tropical Japonica	504	82.30%	0.00%	0.40%	17.26%	NA
Japonica Intermediate	241	81.70%	0.00%	1.24%	17.01%	NA
VI/Aromatic	96	89.60%	0.00%	1.04%	9.38%	NA
Intermediate	90	56.70%	2.20%	1.11%	40.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1000961132	A -> G	LOC_Os10g02530.1	upstream_gene_variant ; 1175.0bp to feature; MODIFIER	silent_mutation	Average:8.066; most accessible tissue: Callus, score: 26.098	N	N	N	N
vg1000961132	A -> G	LOC_Os10g02560.1	downstream_gene_variant ; 4763.0bp to feature; MODIFIER	silent_mutation	Average:8.066; most accessible tissue: Callus, score: 26.098	N	N	N	N
vg1000961132	A -> G	LOC_Os10g02544.1	intron_variant ; MODIFIER	silent_mutation	Average:8.066; most accessible tissue: Callus, score: 26.098	N	N	N	N
vg1000961132	A -> DEL	N	N	silent_mutation	Average:8.066; most accessible tissue: Callus, score: 26.098	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1000961132	NA	2.65E-06	mr1184_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000961132	7.14E-06	3.37E-07	mr1245_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000961132	NA	1.02E-06	mr1278_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000961132	NA	9.45E-06	mr1321_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000961132	NA	3.74E-11	mr1322_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000961132	NA	2.09E-12	mr1325_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000961132	NA	3.23E-06	mr1329_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000961132	NA	6.30E-13	mr1330_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000961132	NA	1.36E-12	mr1338_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000961132	NA	2.53E-06	mr1338_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000961132	NA	1.09E-06	mr1346_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000961132	NA	3.05E-06	mr1360_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000961132	NA	9.09E-07	mr1360_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000961132	NA	5.24E-08	mr1373_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000961132	NA	7.38E-06	mr1373_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000961132	NA	1.05E-06	mr1428_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000961132	NA	9.51E-11	mr1449_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000961132	NA	1.35E-06	mr1497_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000961132	NA	1.31E-06	mr1508_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000961132	NA	7.77E-06	mr1524_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000961132	NA	1.31E-07	mr1527_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000961132	NA	2.46E-06	mr1648_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000961132	NA	1.30E-10	mr1690_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000961132	NA	1.62E-09	mr1715_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000961132	NA	4.16E-06	mr1779_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000961132	NA	9.82E-06	mr1992_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251