\
| Variant ID: vg1000936710 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 936710 |
| Reference Allele: G | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
AGTTACTTCAATGCGATATTTGATACGTATTAAATACAATCCATTCTTCATCTTATGAATTTATTACTGTTTATGCTCTAGAAATATAAGTATAGCTTAA[G/T]
ATGTGAGCCAACTTGAACACAAATGCTATTAGATATTATATCTCTGCATGTTAATAGGCTCTGATCGATGAAACTGTTGGTCAATGATGAGTTTCAAGTT
AACTTGAAACTCATCATTGACCAACAGTTTCATCGATCAGAGCCTATTAACATGCAGAGATATAATATCTAATAGCATTTGTGTTCAAGTTGGCTCACAT[C/A]
TTAAGCTATACTTATATTTCTAGAGCATAAACAGTAATAAATTCATAAGATGAAGAATGGATTGTATTTAATACGTATCAAATATCGCATTGAAGTAACT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 66.50% | 33.50% | 0.08% | 0.00% | NA |
| All Indica | 2759 | 97.60% | 2.30% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 9.80% | 90.10% | 0.07% | 0.00% | NA |
| Aus | 269 | 94.10% | 5.90% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.20% | 1.50% | 0.34% | 0.00% | NA |
| Indica II | 465 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Indica III | 913 | 97.00% | 3.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 96.90% | 3.10% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 2.00% | 98.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 17.90% | 81.90% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 17.80% | 82.20% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 6.20% | 93.80% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 44.40% | 54.40% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1000936710 | G -> T | LOC_Os10g02509.1 | downstream_gene_variant ; 2605.0bp to feature; MODIFIER | silent_mutation | Average:59.548; most accessible tissue: Callus, score: 87.05 | N | N | N | N |
| vg1000936710 | G -> T | LOC_Os10g02500-LOC_Os10g02509 | intergenic_region ; MODIFIER | silent_mutation | Average:59.548; most accessible tissue: Callus, score: 87.05 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1000936710 | NA | 1.03E-10 | mr1325 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000936710 | NA | 7.20E-13 | mr1326 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000936710 | NA | 3.43E-85 | mr1504 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000936710 | NA | 9.49E-11 | mr1553 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000936710 | NA | 1.40E-10 | mr1623 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000936710 | NA | 8.20E-34 | mr1670 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000936710 | NA | 2.35E-26 | mr1686 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000936710 | NA | 3.88E-07 | mr1690 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000936710 | NA | 4.51E-23 | mr1698 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000936710 | NA | 4.55E-06 | mr1698 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000936710 | 4.60E-06 | NA | mr1926 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000936710 | NA | 2.84E-08 | mr1299_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000936710 | NA | 4.20E-10 | mr1595_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000936710 | NA | 5.56E-36 | mr1689_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000936710 | NA | 1.54E-22 | mr1698_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000936710 | 2.29E-07 | 6.79E-09 | mr1698_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000936710 | NA | 5.76E-08 | mr1700_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000936710 | NA | 1.80E-12 | mr1713_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000936710 | NA | 1.76E-10 | mr1756_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |