\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1000933071:

Variant ID: vg1000933071 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 933071
Reference Allele: TAlternative Allele: A
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.98, T: 0.01, others allele: 0.00, population size: 213. )

Flanking Sequence (100 bp) in Reference Genome:


TCTGCTTCCTATTAGGGCCCTTGTGATTTAATAATTTCTATCTTCATTATTATTGCACTTTATATGTGATAAGATCATGTTTTTTTGTCTGTTATGTTTT[T/A]
TTAGTGATGGAGAAACAAAATTGAATATGATAATATTTATGCGAGTATATATTCAGTTTCATATGTAAAGAGTTATGTAATCCTCTATGAACTAATTAGC

Reverse complement sequence

GCTAATTAGTTCATAGAGGATTACATAACTCTTTACATATGAAACTGAATATATACTCGCATAAATATTATCATATTCAATTTTGTTTCTCCATCACTAA[A/T]
AAAACATAACAGACAAAAAAACATGATCTTATCACATATAAAGTGCAATAATAATGAAGATAGAAATTATTAAATCACAAGGGCCCTAATAGGAAGCAGA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.60% 32.20% 0.17% 0.00% NA
All Indica  2759 98.70% 1.10% 0.22% 0.00% NA
All Japonica  1512 10.30% 89.70% 0.07% 0.00% NA
Aus  269 97.80% 1.90% 0.37% 0.00% NA
Indica I  595 98.70% 0.70% 0.67% 0.00% NA
Indica II  465 99.40% 0.60% 0.00% 0.00% NA
Indica III  913 99.50% 0.50% 0.00% 0.00% NA
Indica Intermediate  786 97.50% 2.30% 0.25% 0.00% NA
Temperate Japonica  767 2.60% 97.40% 0.00% 0.00% NA
Tropical Japonica  504 17.90% 81.90% 0.20% 0.00% NA
Japonica Intermediate  241 18.70% 81.30% 0.00% 0.00% NA
VI/Aromatic  96 12.50% 87.50% 0.00% 0.00% NA
Intermediate  90 47.80% 52.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1000933071 T -> A LOC_Os10g02500.1 upstream_gene_variant ; 2772.0bp to feature; MODIFIER silent_mutation Average:55.538; most accessible tissue: Minghui63 root, score: 87.364 N N N N
vg1000933071 T -> A LOC_Os10g02500-LOC_Os10g02509 intergenic_region ; MODIFIER silent_mutation Average:55.538; most accessible tissue: Minghui63 root, score: 87.364 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1000933071 NA 9.58E-69 mr1014 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000933071 NA 3.22E-76 mr1135 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000933071 NA 1.64E-27 mr1414 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000933071 NA 4.99E-90 mr1504 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000933071 NA 2.44E-87 mr1517 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000933071 NA 1.01E-10 mr1553 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000933071 NA 4.85E-36 mr1670 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000933071 NA 6.98E-85 mr1672 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000933071 NA 1.24E-26 mr1686 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000933071 NA 5.34E-07 mr1690 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000933071 NA 5.14E-24 mr1698 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000933071 NA 7.10E-06 mr1698 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000933071 2.46E-06 2.46E-06 mr1168_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000933071 NA 2.92E-23 mr1698_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000933071 7.36E-07 1.02E-09 mr1698_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000933071 NA 1.27E-10 mr1756_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251