\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1000904661:

Variant ID: vg1000904661 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 904661
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCTGATCGGATTAGATCTTTCCTTGTAGCGTAGGAGCGATATCCGCCCTTTGCCGCAGTAACGACGCGATCAATTGGAATTGACTCGCCTGCCCGTTACG[A/G]
AGGCAATCTCATTACGGAGGCAATCTCGGGATGGTCCATTGCAAAAAGGATAGAGACAGGCGTAGGCGCACCGCACGCCTCGCCCCCACGCCCGCCCGGC

Reverse complement sequence

GCCGGGCGGGCGTGGGGGCGAGGCGTGCGGTGCGCCTACGCCTGTCTCTATCCTTTTTGCAATGGACCATCCCGAGATTGCCTCCGTAATGAGATTGCCT[T/C]
CGTAACGGGCAGGCGAGTCAATTCCAATTGATCGCGTCGTTACTGCGGCAAAGGGCGGATATCGCTCCTACGCTACAAGGAAAGATCTAATCCGATCAGA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 61.90% 28.10% 5.54% 4.42% NA
All Indica  2759 87.30% 4.70% 5.65% 2.36% NA
All Japonica  1512 22.40% 74.10% 2.71% 0.79% NA
Aus  269 46.80% 8.90% 11.90% 32.34% NA
Indica I  595 93.90% 0.80% 5.04% 0.17% NA
Indica II  465 94.40% 2.40% 2.37% 0.86% NA
Indica III  913 80.10% 8.80% 7.78% 3.40% NA
Indica Intermediate  786 86.50% 4.20% 5.60% 3.69% NA
Temperate Japonica  767 20.70% 76.00% 3.13% 0.13% NA
Tropical Japonica  504 21.00% 77.80% 0.79% 0.40% NA
Japonica Intermediate  241 30.30% 60.60% 5.39% 3.73% NA
VI/Aromatic  96 8.30% 24.00% 27.08% 40.62% NA
Intermediate  90 51.10% 34.40% 7.78% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1000904661 A -> G LOC_Os10g02470.1 intron_variant ; MODIFIER silent_mutation Average:61.916; most accessible tissue: Zhenshan97 young leaf, score: 76.099 N N N N
vg1000904661 A -> DEL N N silent_mutation Average:61.916; most accessible tissue: Zhenshan97 young leaf, score: 76.099 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1000904661 6.78E-08 3.78E-34 mr1137 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000904661 6.64E-06 3.00E-09 mr1137 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000904661 NA 4.46E-22 mr1548 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000904661 NA 5.83E-06 mr1548 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000904661 1.99E-06 5.97E-31 mr1617 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000904661 NA 2.83E-08 mr1617 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000904661 NA 3.56E-07 mr1051_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000904661 NA 5.43E-06 mr1071_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000904661 NA 7.21E-07 mr1080_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000904661 9.88E-07 6.53E-40 mr1137_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000904661 NA 2.21E-08 mr1137_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000904661 NA 2.84E-06 mr1203_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000904661 NA 7.72E-15 mr1324_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000904661 NA 5.55E-20 mr1383_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000904661 4.09E-06 3.90E-34 mr1617_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000904661 NA 3.89E-08 mr1617_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000904661 NA 5.23E-06 mr1619_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000904661 NA 7.28E-12 mr1705_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000904661 NA 4.44E-07 mr1748_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000904661 NA 2.16E-10 mr1761_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000904661 NA 2.95E-18 mr1945_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251