\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1000880358:

Variant ID: vg1000880358 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 880358
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 277. )

Flanking Sequence (100 bp) in Reference Genome:


CCATTCCATCATCCCTTTCTCTCTCTCTCTCCCTTCTTCTCTCCACGCCTTTTCTCTTCTCTATTTGTGAGGCAACGGGCTAGCATTCACGAAGAGCTTA[T/C]
CGCTCATGGGTTGGCAAAAGAGCAAAGCCATGGTAGTGGTGGTGGCAAGGACGTGGCCAAGCTTAGCACAGCGGCAGCCACACGGATGTGGCCCTGCTCG

Reverse complement sequence

CGAGCAGGGCCACATCCGTGTGGCTGCCGCTGTGCTAAGCTTGGCCACGTCCTTGCCACCACCACTACCATGGCTTTGCTCTTTTGCCAACCCATGAGCG[A/G]
TAAGCTCTTCGTGAATGCTAGCCCGTTGCCTCACAAATAGAGAAGAGAAAAGGCGTGGAGAGAAGAAGGGAGAGAGAGAGAGAAAGGGATGATGGAATGG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 86.60% 8.60% 0.70% 4.06% NA
All Indica  2759 98.50% 0.20% 0.11% 1.23% NA
All Japonica  1512 72.40% 25.80% 1.72% 0.13% NA
Aus  269 42.80% 0.00% 1.12% 56.13% NA
Indica I  595 98.80% 0.00% 0.17% 1.01% NA
Indica II  465 98.90% 0.40% 0.22% 0.43% NA
Indica III  913 99.30% 0.20% 0.00% 0.44% NA
Indica Intermediate  786 96.90% 0.10% 0.13% 2.80% NA
Temperate Japonica  767 49.50% 47.30% 3.13% 0.00% NA
Tropical Japonica  504 98.40% 1.60% 0.00% 0.00% NA
Japonica Intermediate  241 90.50% 7.90% 0.83% 0.83% NA
VI/Aromatic  96 97.90% 0.00% 0.00% 2.08% NA
Intermediate  90 83.30% 12.20% 1.11% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1000880358 T -> C LOC_Os10g02420.1 upstream_gene_variant ; 3971.0bp to feature; MODIFIER silent_mutation Average:66.443; most accessible tissue: Zhenshan97 young leaf, score: 87.993 N N N N
vg1000880358 T -> C LOC_Os10g02410.1 downstream_gene_variant ; 4.0bp to feature; MODIFIER silent_mutation Average:66.443; most accessible tissue: Zhenshan97 young leaf, score: 87.993 N N N N
vg1000880358 T -> C LOC_Os10g02400-LOC_Os10g02410 intergenic_region ; MODIFIER silent_mutation Average:66.443; most accessible tissue: Zhenshan97 young leaf, score: 87.993 N N N N
vg1000880358 T -> DEL N N silent_mutation Average:66.443; most accessible tissue: Zhenshan97 young leaf, score: 87.993 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1000880358 NA 4.26E-06 mr1548 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000880358 NA 1.31E-07 mr1617 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000880358 4.01E-07 NA mr1926 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000880358 NA 1.88E-06 mr1977 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000880358 1.54E-10 NA mr1310_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000880358 NA 6.30E-08 mr1310_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000880358 4.16E-06 NA mr1691_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000880358 1.07E-08 3.17E-16 mr1959_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000880358 NA 1.59E-07 mr1959_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251