\
| Variant ID: vg1000880358 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 880358 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 277. )
CCATTCCATCATCCCTTTCTCTCTCTCTCTCCCTTCTTCTCTCCACGCCTTTTCTCTTCTCTATTTGTGAGGCAACGGGCTAGCATTCACGAAGAGCTTA[T/C]
CGCTCATGGGTTGGCAAAAGAGCAAAGCCATGGTAGTGGTGGTGGCAAGGACGTGGCCAAGCTTAGCACAGCGGCAGCCACACGGATGTGGCCCTGCTCG
CGAGCAGGGCCACATCCGTGTGGCTGCCGCTGTGCTAAGCTTGGCCACGTCCTTGCCACCACCACTACCATGGCTTTGCTCTTTTGCCAACCCATGAGCG[A/G]
TAAGCTCTTCGTGAATGCTAGCCCGTTGCCTCACAAATAGAGAAGAGAAAAGGCGTGGAGAGAAGAAGGGAGAGAGAGAGAGAAAGGGATGATGGAATGG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 86.60% | 8.60% | 0.70% | 4.06% | NA |
| All Indica | 2759 | 98.50% | 0.20% | 0.11% | 1.23% | NA |
| All Japonica | 1512 | 72.40% | 25.80% | 1.72% | 0.13% | NA |
| Aus | 269 | 42.80% | 0.00% | 1.12% | 56.13% | NA |
| Indica I | 595 | 98.80% | 0.00% | 0.17% | 1.01% | NA |
| Indica II | 465 | 98.90% | 0.40% | 0.22% | 0.43% | NA |
| Indica III | 913 | 99.30% | 0.20% | 0.00% | 0.44% | NA |
| Indica Intermediate | 786 | 96.90% | 0.10% | 0.13% | 2.80% | NA |
| Temperate Japonica | 767 | 49.50% | 47.30% | 3.13% | 0.00% | NA |
| Tropical Japonica | 504 | 98.40% | 1.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 90.50% | 7.90% | 0.83% | 0.83% | NA |
| VI/Aromatic | 96 | 97.90% | 0.00% | 0.00% | 2.08% | NA |
| Intermediate | 90 | 83.30% | 12.20% | 1.11% | 3.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1000880358 | T -> C | LOC_Os10g02420.1 | upstream_gene_variant ; 3971.0bp to feature; MODIFIER | silent_mutation | Average:66.443; most accessible tissue: Zhenshan97 young leaf, score: 87.993 | N | N | N | N |
| vg1000880358 | T -> C | LOC_Os10g02410.1 | downstream_gene_variant ; 4.0bp to feature; MODIFIER | silent_mutation | Average:66.443; most accessible tissue: Zhenshan97 young leaf, score: 87.993 | N | N | N | N |
| vg1000880358 | T -> C | LOC_Os10g02400-LOC_Os10g02410 | intergenic_region ; MODIFIER | silent_mutation | Average:66.443; most accessible tissue: Zhenshan97 young leaf, score: 87.993 | N | N | N | N |
| vg1000880358 | T -> DEL | N | N | silent_mutation | Average:66.443; most accessible tissue: Zhenshan97 young leaf, score: 87.993 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1000880358 | NA | 4.26E-06 | mr1548 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000880358 | NA | 1.31E-07 | mr1617 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000880358 | 4.01E-07 | NA | mr1926 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000880358 | NA | 1.88E-06 | mr1977 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000880358 | 1.54E-10 | NA | mr1310_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000880358 | NA | 6.30E-08 | mr1310_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000880358 | 4.16E-06 | NA | mr1691_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000880358 | 1.07E-08 | 3.17E-16 | mr1959_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000880358 | NA | 1.59E-07 | mr1959_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |