| Variant ID: vg1000877655 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 877655 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
GTGGAGATATGGAAAAGAATCCGGATAGTTTCTGACCGTTTCAAATTTCTACCGGATACTGGTCTTAATTACCATATCTCGTCTTTCCAAATTTGTTTCC[A/G]
TTTAAAAAAAACTATCTGTACTCATTTTCAAATCCGGTACTATAAAAAAAAAATCTATTCGAGACTATCCGTTTCTAAAATACGTGCGGGTATCGGAAAC
GTTTCCGATACCCGCACGTATTTTAGAAACGGATAGTCTCGAATAGATTTTTTTTTTATAGTACCGGATTTGAAAATGAGTACAGATAGTTTTTTTTAAA[T/C]
GGAAACAAATTTGGAAAGACGAGATATGGTAATTAAGACCAGTATCCGGTAGAAATTTGAAACGGTCAGAAACTATCCGGATTCTTTTCCATATCTCCAC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 94.10% | 4.40% | 0.21% | 1.21% | NA |
| All Indica | 2759 | 98.70% | 0.50% | 0.07% | 0.76% | NA |
| All Japonica | 1512 | 94.70% | 5.10% | 0.07% | 0.13% | NA |
| Aus | 269 | 44.20% | 41.60% | 2.60% | 11.52% | NA |
| Indica I | 595 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.60% | 0.00% | 0.00% | 0.43% | NA |
| Indica III | 913 | 99.10% | 0.30% | 0.00% | 0.55% | NA |
| Indica Intermediate | 786 | 97.20% | 0.80% | 0.25% | 1.78% | NA |
| Temperate Japonica | 767 | 90.40% | 9.60% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.60% | 0.20% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 98.30% | 0.80% | 0.00% | 0.83% | NA |
| VI/Aromatic | 96 | 97.90% | 0.00% | 0.00% | 2.08% | NA |
| Intermediate | 90 | 91.10% | 7.80% | 0.00% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1000877655 | A -> G | LOC_Os10g02400.1 | downstream_gene_variant ; 3313.0bp to feature; MODIFIER | silent_mutation | Average:34.652; most accessible tissue: Zhenshan97 panicle, score: 52.263 | N | N | N | N |
| vg1000877655 | A -> G | LOC_Os10g02410.1 | downstream_gene_variant ; 2707.0bp to feature; MODIFIER | silent_mutation | Average:34.652; most accessible tissue: Zhenshan97 panicle, score: 52.263 | N | N | N | N |
| vg1000877655 | A -> G | LOC_Os10g02400-LOC_Os10g02410 | intergenic_region ; MODIFIER | silent_mutation | Average:34.652; most accessible tissue: Zhenshan97 panicle, score: 52.263 | N | N | N | N |
| vg1000877655 | A -> DEL | N | N | silent_mutation | Average:34.652; most accessible tissue: Zhenshan97 panicle, score: 52.263 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1000877655 | 1.31E-06 | NA | mr1210 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000877655 | 8.91E-06 | NA | mr1585 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000877655 | 8.43E-07 | NA | mr1586 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000877655 | NA | 3.70E-06 | mr1586 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000877655 | 4.92E-07 | NA | mr1765 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000877655 | NA | 4.36E-06 | mr1765 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |