\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1000868695:

Variant ID: vg1000868695 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 868695
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GATGCATTCCCGACGAGCTAATTTCATTTCACTATTTTTGTTGTGATTTTAGATACATGTTTAAAATTTTGGGTTTATTTTTAAACCACCTATCTCCTTT[A/G]
CTTGCAGTTATTTATCATTCAATTAGTGAAGCATAAACTCATTCGATATTCTGATATTAATCAAAATTAATATTATTTAATTTCCTTTAGAAAGAAAACA

Reverse complement sequence

TGTTTTCTTTCTAAAGGAAATTAAATAATATTAATTTTGATTAATATCAGAATATCGAATGAGTTTATGCTTCACTAATTGAATGATAAATAACTGCAAG[T/C]
AAAGGAGATAGGTGGTTTAAAAATAAACCCAAAATTTTAAACATGTATCTAAAATCACAACAAAAATAGTGAAATGAAATTAGCTCGTCGGGAATGCATC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 85.60% 11.70% 1.27% 1.48% NA
All Indica  2759 98.70% 0.30% 0.18% 0.83% NA
All Japonica  1512 61.40% 35.10% 3.37% 0.13% NA
Aus  269 83.30% 0.40% 0.74% 15.61% NA
Indica I  595 99.70% 0.00% 0.34% 0.00% NA
Indica II  465 98.90% 0.60% 0.22% 0.22% NA
Indica III  913 99.30% 0.20% 0.00% 0.44% NA
Indica Intermediate  786 96.90% 0.50% 0.25% 2.29% NA
Temperate Japonica  767 37.90% 55.90% 6.13% 0.00% NA
Tropical Japonica  504 95.40% 4.60% 0.00% 0.00% NA
Japonica Intermediate  241 64.70% 32.80% 1.66% 0.83% NA
VI/Aromatic  96 97.90% 0.00% 0.00% 2.08% NA
Intermediate  90 84.40% 12.20% 2.22% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1000868695 A -> G LOC_Os10g02400.1 upstream_gene_variant ; 4985.0bp to feature; MODIFIER silent_mutation Average:46.552; most accessible tissue: Callus, score: 73.921 N N N N
vg1000868695 A -> G LOC_Os10g02380.1 intron_variant ; MODIFIER silent_mutation Average:46.552; most accessible tissue: Callus, score: 73.921 N N N N
vg1000868695 A -> DEL N N silent_mutation Average:46.552; most accessible tissue: Callus, score: 73.921 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1000868695 4.72E-07 1.06E-30 mr1137 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000868695 NA 4.43E-10 mr1137 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000868695 NA 8.72E-06 mr1164 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000868695 NA 4.52E-06 mr1202 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000868695 1.32E-07 1.05E-21 mr1300 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000868695 3.84E-07 NA mr1310 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000868695 NA 2.19E-06 mr1378 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000868695 NA 1.32E-06 mr1548 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000868695 3.68E-08 3.28E-29 mr1617 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000868695 NA 1.20E-10 mr1617 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000868695 NA 3.51E-08 mr1748 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000868695 2.69E-09 NA mr1926 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000868695 NA 1.65E-09 mr1959 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000868695 NA 3.39E-06 mr1057_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000868695 1.06E-06 NA mr1137_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000868695 NA 3.63E-09 mr1137_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000868695 2.63E-06 7.53E-06 mr1158_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000868695 5.31E-12 2.00E-37 mr1310_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000868695 NA 7.23E-10 mr1310_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000868695 NA 6.41E-07 mr1617_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000868695 3.71E-07 7.70E-19 mr1959_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000868695 NA 7.11E-07 mr1959_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251