\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1000865461:

Variant ID: vg1000865461 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 865461
Reference Allele: TAlternative Allele: A
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.97, T: 0.03, others allele: 0.00, population size: 100. )

Flanking Sequence (100 bp) in Reference Genome:


CCAAGGGTTCCCAACACCTCTCCATCGTTTTCCGCGTGCACGCTTTTCAAACTGCTAAACGGTGTGTTTTTTGTAAAAAGTTTCTATACAAAAATTGCTT[T/A]
AAAAAATCATATTGATTCATTTTTGAAAAAAAAAGCTAATTTCTAATTAATCACGCGTTAATGGACCGCTCCGTTTTCCGTGCGAAGAAGATTTGTTCCC

Reverse complement sequence

GGGAACAAATCTTCTTCGCACGGAAAACGGAGCGGTCCATTAACGCGTGATTAATTAGAAATTAGCTTTTTTTTTCAAAAATGAATCAATATGATTTTTT[A/T]
AAGCAATTTTTGTATAGAAACTTTTTACAAAAAACACACCGTTTAGCAGTTTGAAAAGCGTGCACGCGGAAAACGATGGAGAGGTGTTGGGAACCCTTGG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 16.20% 13.90% 0.89% 69.04% NA
All Indica  2759 19.50% 0.80% 1.30% 78.40% NA
All Japonica  1512 13.00% 40.90% 0.20% 45.90% NA
Aus  269 4.10% 0.40% 0.00% 95.54% NA
Indica I  595 17.50% 0.80% 0.17% 81.51% NA
Indica II  465 5.40% 1.30% 2.37% 90.97% NA
Indica III  913 23.40% 0.40% 0.66% 75.47% NA
Indica Intermediate  786 24.80% 0.90% 2.29% 72.01% NA
Temperate Japonica  767 17.90% 69.60% 0.13% 12.39% NA
Tropical Japonica  504 3.00% 3.20% 0.20% 93.65% NA
Japonica Intermediate  241 18.70% 28.20% 0.41% 52.70% NA
VI/Aromatic  96 8.30% 0.00% 0.00% 91.67% NA
Intermediate  90 11.10% 17.80% 3.33% 67.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1000865461 T -> A LOC_Os10g02380.1 upstream_gene_variant ; 928.0bp to feature; MODIFIER silent_mutation Average:50.765; most accessible tissue: Callus, score: 84.237 N N N N
vg1000865461 T -> A LOC_Os10g02360-LOC_Os10g02380 intergenic_region ; MODIFIER silent_mutation Average:50.765; most accessible tissue: Callus, score: 84.237 N N N N
vg1000865461 T -> DEL N N silent_mutation Average:50.765; most accessible tissue: Callus, score: 84.237 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1000865461 NA 6.84E-06 mr1026 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000865461 NA 8.03E-06 mr1042 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000865461 NA 2.75E-06 mr1063 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000865461 NA 5.67E-06 mr1072 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000865461 NA 8.46E-06 mr1077 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000865461 NA 1.10E-22 mr1115 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000865461 NA 2.77E-31 mr1137 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000865461 NA 3.73E-09 mr1137 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000865461 NA 3.00E-07 mr1163 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000865461 NA 6.91E-06 mr1192 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000865461 NA 2.83E-06 mr1202 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000865461 NA 2.01E-06 mr1252 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000865461 NA 2.23E-21 mr1300 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000865461 NA 3.24E-06 mr1482 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000865461 NA 5.33E-38 mr1486 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000865461 NA 1.43E-12 mr1486 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000865461 NA 4.95E-06 mr1531 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000865461 5.32E-06 2.02E-23 mr1548 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000865461 5.70E-06 7.96E-11 mr1548 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000865461 NA 2.26E-07 mr1570 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000865461 NA 5.53E-06 mr1576 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000865461 NA 3.40E-06 mr1588 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000865461 NA 8.15E-24 mr1611 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000865461 2.95E-08 9.41E-33 mr1617 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000865461 NA 1.01E-10 mr1617 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000865461 NA 7.04E-07 mr1627 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000865461 NA 1.51E-07 mr1715 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000865461 NA 3.18E-12 mr1741 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000865461 NA 1.59E-06 mr1748 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000865461 NA 4.78E-08 mr1825 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000865461 NA 4.09E-07 mr1912 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000865461 NA 2.70E-24 mr1920 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000865461 NA 4.61E-12 mr1959 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000865461 9.90E-08 2.65E-37 mr1310_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000865461 NA 6.24E-09 mr1310_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000865461 1.43E-08 8.18E-47 mr1486_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000865461 2.44E-06 8.89E-14 mr1486_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000865461 NA 4.41E-06 mr1588_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000865461 NA 1.80E-17 mr1959_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000865461 NA 5.09E-06 mr1959_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251