\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1000830764:

Variant ID: vg1000830764 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 830764
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CACATACCATGTCCTATACGGAAACAACCTGCGGATATGGAGGGAGTTCCGGATAAGGAAAGACAACTAGAGTTCTACATGGAAACGATAATGACTACTC[A/G]
GATTGTATCCATATTGGTTTCCCTCGTTCTACTTGGACAAGGGGACACCTATGGGTATAAATACAAGACCCCCTAGGAGGAGAGGGGAGAACCACCACGG

Reverse complement sequence

CCGTGGTGGTTCTCCCCTCTCCTCCTAGGGGGTCTTGTATTTATACCCATAGGTGTCCCCTTGTCCAAGTAGAACGAGGGAAACCAATATGGATACAATC[T/C]
GAGTAGTCATTATCGTTTCCATGTAGAACTCTAGTTGTCTTTCCTTATCCGGAACTCCCTCCATATCCGCAGGTTGTTTCCGTATAGGACATGGTATGTG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 16.90% 0.10% 11.36% 71.63% NA
All Indica  2759 1.70% 0.10% 15.98% 82.20% NA
All Japonica  1512 47.90% 0.10% 0.93% 51.06% NA
Aus  269 2.60% 0.00% 25.28% 72.12% NA
Indica I  595 2.40% 0.20% 12.77% 84.71% NA
Indica II  465 2.20% 0.00% 2.37% 95.48% NA
Indica III  913 0.90% 0.20% 22.78% 76.12% NA
Indica Intermediate  786 1.90% 0.00% 18.58% 79.52% NA
Temperate Japonica  767 77.40% 0.10% 1.17% 21.25% NA
Tropical Japonica  504 5.00% 0.00% 0.00% 95.04% NA
Japonica Intermediate  241 44.00% 0.00% 2.07% 53.94% NA
VI/Aromatic  96 1.00% 3.10% 8.33% 87.50% NA
Intermediate  90 18.90% 0.00% 6.67% 74.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1000830764 A -> G LOC_Os10g02300.1 upstream_gene_variant ; 4455.0bp to feature; MODIFIER silent_mutation Average:23.663; most accessible tissue: Minghui63 root, score: 40.262 N N N N
vg1000830764 A -> G LOC_Os10g02330.1 upstream_gene_variant ; 2931.0bp to feature; MODIFIER silent_mutation Average:23.663; most accessible tissue: Minghui63 root, score: 40.262 N N N N
vg1000830764 A -> G LOC_Os10g02300.3 upstream_gene_variant ; 4455.0bp to feature; MODIFIER silent_mutation Average:23.663; most accessible tissue: Minghui63 root, score: 40.262 N N N N
vg1000830764 A -> G LOC_Os10g02300.2 upstream_gene_variant ; 4455.0bp to feature; MODIFIER silent_mutation Average:23.663; most accessible tissue: Minghui63 root, score: 40.262 N N N N
vg1000830764 A -> G LOC_Os10g02314.1 intron_variant ; MODIFIER silent_mutation Average:23.663; most accessible tissue: Minghui63 root, score: 40.262 N N N N
vg1000830764 A -> DEL N N silent_mutation Average:23.663; most accessible tissue: Minghui63 root, score: 40.262 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1000830764 6.61E-06 3.89E-19 mr1156 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000830764 NA 1.07E-06 mr1156 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000830764 NA 3.03E-07 mr1163 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000830764 NA 1.89E-06 mr1192 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000830764 2.49E-08 1.01E-26 mr1300 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000830764 NA 1.01E-08 mr1300 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000830764 1.28E-09 1.41E-42 mr1310 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000830764 NA 1.02E-10 mr1310 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000830764 NA 1.86E-06 mr1482 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000830764 NA 2.03E-06 mr1531 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000830764 NA 8.05E-06 mr1548 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000830764 NA 6.91E-10 mr1549 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000830764 NA 4.26E-07 mr1570 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000830764 NA 7.28E-11 mr1624 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000830764 NA 2.03E-06 mr1668 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000830764 NA 3.07E-13 mr1740 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000830764 NA 5.59E-14 mr1741 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000830764 NA 6.22E-10 mr1757 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000830764 NA 3.93E-07 mr1780 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000830764 NA 4.51E-08 mr1785 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000830764 2.71E-06 NA mr1825 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000830764 NA 8.57E-09 mr1825 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000830764 5.23E-10 1.40E-46 mr1926 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000830764 NA 2.41E-10 mr1926 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000830764 NA 1.19E-10 mr1959 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000830764 5.64E-10 4.13E-41 mr1310_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000830764 NA 3.51E-12 mr1310_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000830764 NA 2.20E-09 mr1486_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000830764 NA 8.67E-06 mr1549_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000830764 NA 3.19E-11 mr1624_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000830764 NA 2.61E-15 mr1959_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000830764 NA 1.10E-06 mr1959_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251