\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1000803065:

Variant ID: vg1000803065 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 803065
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.04, others allele: 0.00, population size: 28. )

Flanking Sequence (100 bp) in Reference Genome:


TTAAGTTTGATCTACTAAGTCGAGCTTAGAATCATAATCACTAGTCTGCTTGTTGATTGCCAATAAGGGTTTCATTGGGGTTTTAGCCGATGAGATATCT[G/A]
GATATTGCATCGGCTTATAAGGATTGCATACAAGTTGGATTTAGCCGATAAGAATAAAGGTTTTACTATTTATCTAATCATTTAGAAAAAAAAAAGTGTG

Reverse complement sequence

CACACTTTTTTTTTTCTAAATGATTAGATAAATAGTAAAACCTTTATTCTTATCGGCTAAATCCAACTTGTATGCAATCCTTATAAGCCGATGCAATATC[C/T]
AGATATCTCATCGGCTAAAACCCCAATGAAACCCTTATTGGCAATCAACAAGCAGACTAGTGATTATGATTCTAAGCTCGACTTAGTAGATCAAACTTAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 27.60% 23.80% 0.42% 48.24% NA
All Indica  2759 19.40% 32.20% 0.36% 48.02% NA
All Japonica  1512 48.60% 2.60% 0.40% 48.41% NA
Aus  269 2.20% 36.10% 0.37% 61.34% NA
Indica I  595 19.00% 45.20% 0.34% 35.46% NA
Indica II  465 4.90% 20.40% 0.86% 73.76% NA
Indica III  913 21.80% 30.00% 0.11% 48.08% NA
Indica Intermediate  786 25.60% 31.80% 0.38% 42.24% NA
Temperate Japonica  767 77.80% 0.40% 0.52% 21.25% NA
Tropical Japonica  504 5.80% 2.80% 0.40% 91.07% NA
Japonica Intermediate  241 45.20% 9.10% 0.00% 45.64% NA
VI/Aromatic  96 2.10% 87.50% 1.04% 9.38% NA
Intermediate  90 26.70% 16.70% 2.22% 54.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1000803065 G -> A LOC_Os10g02250.1 upstream_gene_variant ; 3697.0bp to feature; MODIFIER silent_mutation Average:23.724; most accessible tissue: Callus, score: 56.866 N N N N
vg1000803065 G -> A LOC_Os10g02260.1 downstream_gene_variant ; 2598.0bp to feature; MODIFIER silent_mutation Average:23.724; most accessible tissue: Callus, score: 56.866 N N N N
vg1000803065 G -> A LOC_Os10g02260.2 downstream_gene_variant ; 2604.0bp to feature; MODIFIER silent_mutation Average:23.724; most accessible tissue: Callus, score: 56.866 N N N N
vg1000803065 G -> A LOC_Os10g02250-LOC_Os10g02260 intergenic_region ; MODIFIER silent_mutation Average:23.724; most accessible tissue: Callus, score: 56.866 N N N N
vg1000803065 G -> DEL N N silent_mutation Average:23.724; most accessible tissue: Callus, score: 56.866 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1000803065 NA 1.23E-06 mr1098_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000803065 3.93E-06 3.93E-06 mr1230_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000803065 2.97E-06 6.12E-07 mr1415_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000803065 NA 1.73E-06 mr1853_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000803065 NA 9.73E-06 mr1884_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251