\
| Variant ID: vg1000803065 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 803065 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.04, others allele: 0.00, population size: 28. )
TTAAGTTTGATCTACTAAGTCGAGCTTAGAATCATAATCACTAGTCTGCTTGTTGATTGCCAATAAGGGTTTCATTGGGGTTTTAGCCGATGAGATATCT[G/A]
GATATTGCATCGGCTTATAAGGATTGCATACAAGTTGGATTTAGCCGATAAGAATAAAGGTTTTACTATTTATCTAATCATTTAGAAAAAAAAAAGTGTG
CACACTTTTTTTTTTCTAAATGATTAGATAAATAGTAAAACCTTTATTCTTATCGGCTAAATCCAACTTGTATGCAATCCTTATAAGCCGATGCAATATC[C/T]
AGATATCTCATCGGCTAAAACCCCAATGAAACCCTTATTGGCAATCAACAAGCAGACTAGTGATTATGATTCTAAGCTCGACTTAGTAGATCAAACTTAA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 27.60% | 23.80% | 0.42% | 48.24% | NA |
| All Indica | 2759 | 19.40% | 32.20% | 0.36% | 48.02% | NA |
| All Japonica | 1512 | 48.60% | 2.60% | 0.40% | 48.41% | NA |
| Aus | 269 | 2.20% | 36.10% | 0.37% | 61.34% | NA |
| Indica I | 595 | 19.00% | 45.20% | 0.34% | 35.46% | NA |
| Indica II | 465 | 4.90% | 20.40% | 0.86% | 73.76% | NA |
| Indica III | 913 | 21.80% | 30.00% | 0.11% | 48.08% | NA |
| Indica Intermediate | 786 | 25.60% | 31.80% | 0.38% | 42.24% | NA |
| Temperate Japonica | 767 | 77.80% | 0.40% | 0.52% | 21.25% | NA |
| Tropical Japonica | 504 | 5.80% | 2.80% | 0.40% | 91.07% | NA |
| Japonica Intermediate | 241 | 45.20% | 9.10% | 0.00% | 45.64% | NA |
| VI/Aromatic | 96 | 2.10% | 87.50% | 1.04% | 9.38% | NA |
| Intermediate | 90 | 26.70% | 16.70% | 2.22% | 54.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1000803065 | G -> A | LOC_Os10g02250.1 | upstream_gene_variant ; 3697.0bp to feature; MODIFIER | silent_mutation | Average:23.724; most accessible tissue: Callus, score: 56.866 | N | N | N | N |
| vg1000803065 | G -> A | LOC_Os10g02260.1 | downstream_gene_variant ; 2598.0bp to feature; MODIFIER | silent_mutation | Average:23.724; most accessible tissue: Callus, score: 56.866 | N | N | N | N |
| vg1000803065 | G -> A | LOC_Os10g02260.2 | downstream_gene_variant ; 2604.0bp to feature; MODIFIER | silent_mutation | Average:23.724; most accessible tissue: Callus, score: 56.866 | N | N | N | N |
| vg1000803065 | G -> A | LOC_Os10g02250-LOC_Os10g02260 | intergenic_region ; MODIFIER | silent_mutation | Average:23.724; most accessible tissue: Callus, score: 56.866 | N | N | N | N |
| vg1000803065 | G -> DEL | N | N | silent_mutation | Average:23.724; most accessible tissue: Callus, score: 56.866 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1000803065 | NA | 1.23E-06 | mr1098_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000803065 | 3.93E-06 | 3.93E-06 | mr1230_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000803065 | 2.97E-06 | 6.12E-07 | mr1415_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000803065 | NA | 1.73E-06 | mr1853_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000803065 | NA | 9.73E-06 | mr1884_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |