\
| Variant ID: vg1000766238 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 766238 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
GGAATCAGTCACATTGCAGGTATTCTCTTTATTTAATAACTAGTATGGTGGTCCGCGCAGATTGTGCGGCTAGCATCATTATATTTTCTCTCATATAATA[G/A]
CATATATATTTTCTCAATGTATTATTCAAATATGTTAAAATGGCAACATAATTTTAAATTTTGTACTATCTTTACGAAACTACTAATGTGTAATATTCAT
ATGAATATTACACATTAGTAGTTTCGTAAAGATAGTACAAAATTTAAAATTATGTTGCCATTTTAACATATTTGAATAATACATTGAGAAAATATATATG[C/T]
TATTATATGAGAGAAAATATAATGATGCTAGCCGCACAATCTGCGCGGACCACCATACTAGTTATTAAATAAAGAGAATACCTGCAATGTGACTGATTCC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 73.20% | 6.20% | 18.39% | 2.20% | NA |
| All Indica | 2759 | 81.10% | 1.00% | 16.53% | 1.34% | NA |
| All Japonica | 1512 | 56.90% | 13.00% | 25.86% | 4.30% | NA |
| Aus | 269 | 94.10% | 5.90% | 0.00% | 0.00% | NA |
| Indica I | 595 | 84.70% | 0.00% | 13.95% | 1.34% | NA |
| Indica II | 465 | 73.80% | 0.00% | 24.95% | 1.29% | NA |
| Indica III | 913 | 79.00% | 2.60% | 16.54% | 1.86% | NA |
| Indica Intermediate | 786 | 85.20% | 0.50% | 13.49% | 0.76% | NA |
| Temperate Japonica | 767 | 72.50% | 19.00% | 7.04% | 1.43% | NA |
| Tropical Japonica | 504 | 33.90% | 2.00% | 54.76% | 9.33% | NA |
| Japonica Intermediate | 241 | 55.20% | 16.60% | 25.31% | 2.90% | NA |
| VI/Aromatic | 96 | 56.20% | 43.80% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 58.90% | 14.40% | 24.44% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1000766238 | G -> A | LOC_Os10g02210.1 | upstream_gene_variant ; 926.0bp to feature; MODIFIER | silent_mutation | Average:45.595; most accessible tissue: Zhenshan97 young leaf, score: 56.533 | N | N | N | N |
| vg1000766238 | G -> A | LOC_Os10g02210-LOC_Os10g02220 | intergenic_region ; MODIFIER | silent_mutation | Average:45.595; most accessible tissue: Zhenshan97 young leaf, score: 56.533 | N | N | N | N |
| vg1000766238 | G -> DEL | N | N | silent_mutation | Average:45.595; most accessible tissue: Zhenshan97 young leaf, score: 56.533 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1000766238 | NA | 4.15E-10 | mr1549 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000766238 | 6.12E-06 | NA | mr1757 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000766238 | NA | 5.81E-09 | mr1757 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000766238 | 1.43E-07 | NA | mr1549_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000766238 | NA | 2.05E-09 | mr1549_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000766238 | 7.15E-07 | NA | mr1757_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000766238 | NA | 6.30E-09 | mr1757_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |