\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1000766238:

Variant ID: vg1000766238 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 766238
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GGAATCAGTCACATTGCAGGTATTCTCTTTATTTAATAACTAGTATGGTGGTCCGCGCAGATTGTGCGGCTAGCATCATTATATTTTCTCTCATATAATA[G/A]
CATATATATTTTCTCAATGTATTATTCAAATATGTTAAAATGGCAACATAATTTTAAATTTTGTACTATCTTTACGAAACTACTAATGTGTAATATTCAT

Reverse complement sequence

ATGAATATTACACATTAGTAGTTTCGTAAAGATAGTACAAAATTTAAAATTATGTTGCCATTTTAACATATTTGAATAATACATTGAGAAAATATATATG[C/T]
TATTATATGAGAGAAAATATAATGATGCTAGCCGCACAATCTGCGCGGACCACCATACTAGTTATTAAATAAAGAGAATACCTGCAATGTGACTGATTCC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 73.20% 6.20% 18.39% 2.20% NA
All Indica  2759 81.10% 1.00% 16.53% 1.34% NA
All Japonica  1512 56.90% 13.00% 25.86% 4.30% NA
Aus  269 94.10% 5.90% 0.00% 0.00% NA
Indica I  595 84.70% 0.00% 13.95% 1.34% NA
Indica II  465 73.80% 0.00% 24.95% 1.29% NA
Indica III  913 79.00% 2.60% 16.54% 1.86% NA
Indica Intermediate  786 85.20% 0.50% 13.49% 0.76% NA
Temperate Japonica  767 72.50% 19.00% 7.04% 1.43% NA
Tropical Japonica  504 33.90% 2.00% 54.76% 9.33% NA
Japonica Intermediate  241 55.20% 16.60% 25.31% 2.90% NA
VI/Aromatic  96 56.20% 43.80% 0.00% 0.00% NA
Intermediate  90 58.90% 14.40% 24.44% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1000766238 G -> A LOC_Os10g02210.1 upstream_gene_variant ; 926.0bp to feature; MODIFIER silent_mutation Average:45.595; most accessible tissue: Zhenshan97 young leaf, score: 56.533 N N N N
vg1000766238 G -> A LOC_Os10g02210-LOC_Os10g02220 intergenic_region ; MODIFIER silent_mutation Average:45.595; most accessible tissue: Zhenshan97 young leaf, score: 56.533 N N N N
vg1000766238 G -> DEL N N silent_mutation Average:45.595; most accessible tissue: Zhenshan97 young leaf, score: 56.533 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1000766238 NA 4.15E-10 mr1549 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000766238 6.12E-06 NA mr1757 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000766238 NA 5.81E-09 mr1757 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000766238 1.43E-07 NA mr1549_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000766238 NA 2.05E-09 mr1549_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000766238 7.15E-07 NA mr1757_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000766238 NA 6.30E-09 mr1757_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251