\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1000757961:

Variant ID: vg1000757961 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 757961
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.76, A: 0.24, others allele: 0.00, population size: 85. )

Flanking Sequence (100 bp) in Reference Genome:


TTGTGGGCTATCTCCGCCCAATGTCTCTGCTATCTTGGCATGTGCATACGGCATGACATGCATGCAGTGTTCTCCCTCTTTACTATCAATGGCCATATAT[A/G]
TATGGCACGTATATTTTCCAGCCACATATGAAACGTGGATCACTATAGTTCAATTTGCACTCTAATTACCATCTAAACATAGATTAATGTAATTTGTCTG

Reverse complement sequence

CAGACAAATTACATTAATCTATGTTTAGATGGTAATTAGAGTGCAAATTGAACTATAGTGATCCACGTTTCATATGTGGCTGGAAAATATACGTGCCATA[T/C]
ATATATGGCCATTGATAGTAAAGAGGGAGAACACTGCATGCATGTCATGCCGTATGCACATGCCAAGATAGCAGAGACATTGGGCGGAGATAGCCCACAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 41.80% 16.80% 1.23% 40.20% NA
All Indica  2759 52.80% 0.80% 1.01% 45.34% NA
All Japonica  1512 8.60% 49.30% 1.79% 40.34% NA
Aus  269 98.50% 1.10% 0.37% 0.00% NA
Indica I  595 62.90% 1.00% 0.34% 35.80% NA
Indica II  465 24.50% 1.70% 0.65% 73.12% NA
Indica III  913 55.10% 0.20% 1.75% 42.94% NA
Indica Intermediate  786 59.30% 0.90% 0.89% 38.93% NA
Temperate Japonica  767 10.00% 78.50% 0.00% 11.47% NA
Tropical Japonica  504 3.60% 6.90% 5.16% 84.33% NA
Japonica Intermediate  241 14.50% 44.80% 0.41% 40.25% NA
VI/Aromatic  96 92.70% 7.30% 0.00% 0.00% NA
Intermediate  90 37.80% 16.70% 2.22% 43.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1000757961 A -> G LOC_Os10g02200.1 upstream_gene_variant ; 3123.0bp to feature; MODIFIER silent_mutation Average:28.129; most accessible tissue: Zhenshan97 flower, score: 57.454 N N N N
vg1000757961 A -> G LOC_Os10g02210.1 downstream_gene_variant ; 3220.0bp to feature; MODIFIER silent_mutation Average:28.129; most accessible tissue: Zhenshan97 flower, score: 57.454 N N N N
vg1000757961 A -> G LOC_Os10g02200-LOC_Os10g02210 intergenic_region ; MODIFIER silent_mutation Average:28.129; most accessible tissue: Zhenshan97 flower, score: 57.454 N N N N
vg1000757961 A -> DEL N N silent_mutation Average:28.129; most accessible tissue: Zhenshan97 flower, score: 57.454 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1000757961 4.94E-27 6.73E-49 mr1300 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000757961 1.30E-13 1.74E-18 mr1300 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000757961 8.13E-30 5.13E-71 mr1310 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000757961 4.62E-14 1.92E-21 mr1310 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000757961 1.80E-39 2.97E-87 mr1926 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000757961 3.19E-16 1.32E-25 mr1926 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000757961 3.62E-14 1.81E-20 mr1959 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000757961 1.10E-09 5.80E-12 mr1959 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000757961 9.65E-40 2.20E-76 mr1310_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000757961 3.71E-20 4.01E-32 mr1310_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000757961 4.69E-19 7.01E-31 mr1959_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000757961 6.93E-12 4.98E-19 mr1959_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251