\
| Variant ID: vg1000757961 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 757961 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.76, A: 0.24, others allele: 0.00, population size: 85. )
TTGTGGGCTATCTCCGCCCAATGTCTCTGCTATCTTGGCATGTGCATACGGCATGACATGCATGCAGTGTTCTCCCTCTTTACTATCAATGGCCATATAT[A/G]
TATGGCACGTATATTTTCCAGCCACATATGAAACGTGGATCACTATAGTTCAATTTGCACTCTAATTACCATCTAAACATAGATTAATGTAATTTGTCTG
CAGACAAATTACATTAATCTATGTTTAGATGGTAATTAGAGTGCAAATTGAACTATAGTGATCCACGTTTCATATGTGGCTGGAAAATATACGTGCCATA[T/C]
ATATATGGCCATTGATAGTAAAGAGGGAGAACACTGCATGCATGTCATGCCGTATGCACATGCCAAGATAGCAGAGACATTGGGCGGAGATAGCCCACAA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 41.80% | 16.80% | 1.23% | 40.20% | NA |
| All Indica | 2759 | 52.80% | 0.80% | 1.01% | 45.34% | NA |
| All Japonica | 1512 | 8.60% | 49.30% | 1.79% | 40.34% | NA |
| Aus | 269 | 98.50% | 1.10% | 0.37% | 0.00% | NA |
| Indica I | 595 | 62.90% | 1.00% | 0.34% | 35.80% | NA |
| Indica II | 465 | 24.50% | 1.70% | 0.65% | 73.12% | NA |
| Indica III | 913 | 55.10% | 0.20% | 1.75% | 42.94% | NA |
| Indica Intermediate | 786 | 59.30% | 0.90% | 0.89% | 38.93% | NA |
| Temperate Japonica | 767 | 10.00% | 78.50% | 0.00% | 11.47% | NA |
| Tropical Japonica | 504 | 3.60% | 6.90% | 5.16% | 84.33% | NA |
| Japonica Intermediate | 241 | 14.50% | 44.80% | 0.41% | 40.25% | NA |
| VI/Aromatic | 96 | 92.70% | 7.30% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 37.80% | 16.70% | 2.22% | 43.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1000757961 | A -> G | LOC_Os10g02200.1 | upstream_gene_variant ; 3123.0bp to feature; MODIFIER | silent_mutation | Average:28.129; most accessible tissue: Zhenshan97 flower, score: 57.454 | N | N | N | N |
| vg1000757961 | A -> G | LOC_Os10g02210.1 | downstream_gene_variant ; 3220.0bp to feature; MODIFIER | silent_mutation | Average:28.129; most accessible tissue: Zhenshan97 flower, score: 57.454 | N | N | N | N |
| vg1000757961 | A -> G | LOC_Os10g02200-LOC_Os10g02210 | intergenic_region ; MODIFIER | silent_mutation | Average:28.129; most accessible tissue: Zhenshan97 flower, score: 57.454 | N | N | N | N |
| vg1000757961 | A -> DEL | N | N | silent_mutation | Average:28.129; most accessible tissue: Zhenshan97 flower, score: 57.454 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1000757961 | 4.94E-27 | 6.73E-49 | mr1300 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000757961 | 1.30E-13 | 1.74E-18 | mr1300 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000757961 | 8.13E-30 | 5.13E-71 | mr1310 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000757961 | 4.62E-14 | 1.92E-21 | mr1310 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000757961 | 1.80E-39 | 2.97E-87 | mr1926 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000757961 | 3.19E-16 | 1.32E-25 | mr1926 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000757961 | 3.62E-14 | 1.81E-20 | mr1959 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000757961 | 1.10E-09 | 5.80E-12 | mr1959 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000757961 | 9.65E-40 | 2.20E-76 | mr1310_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000757961 | 3.71E-20 | 4.01E-32 | mr1310_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000757961 | 4.69E-19 | 7.01E-31 | mr1959_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000757961 | 6.93E-12 | 4.98E-19 | mr1959_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |