\
| Variant ID: vg1000756369 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 756369 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.76, T: 0.24, others allele: 0.00, population size: 97. )
CCGTCCACTGTCTTTTCTCTTTATTGTCATTGGAATTTTAAAAATCAAACATAATTACTGTTCGGGTTCATTTTTTTACTTTCTAGAAGTCCCACCAAAC[T/C]
GTCAGGGGCTTTGCTATTGTACTCCTCTATGGCTCGTCCGCTGCCTCCCTTCTTTATTGTCATTGAGATTTTAAAATCGACCATGATTATCATTGTTTTT
AAAAACAATGATAATCATGGTCGATTTTAAAATCTCAATGACAATAAAGAAGGGAGGCAGCGGACGAGCCATAGAGGAGTACAATAGCAAAGCCCCTGAC[A/G]
GTTTGGTGGGACTTCTAGAAAGTAAAAAAATGAACCCGAACAGTAATTATGTTTGATTTTTAAAATTCCAATGACAATAAAGAGAAAAGACAGTGGACGG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 42.10% | 16.60% | 0.74% | 40.56% | NA |
| All Indica | 2759 | 53.30% | 0.70% | 0.69% | 45.31% | NA |
| All Japonica | 1512 | 8.70% | 48.70% | 0.79% | 41.73% | NA |
| Aus | 269 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Indica I | 595 | 63.00% | 0.70% | 0.00% | 36.30% | NA |
| Indica II | 465 | 24.90% | 0.90% | 0.86% | 73.33% | NA |
| Indica III | 913 | 55.80% | 0.50% | 1.42% | 42.28% | NA |
| Indica Intermediate | 786 | 59.90% | 0.80% | 0.25% | 39.06% | NA |
| Temperate Japonica | 767 | 9.90% | 78.40% | 0.00% | 11.73% | NA |
| Tropical Japonica | 504 | 4.20% | 5.60% | 2.38% | 87.90% | NA |
| Japonica Intermediate | 241 | 14.50% | 44.80% | 0.00% | 40.66% | NA |
| VI/Aromatic | 96 | 93.80% | 6.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 35.60% | 20.00% | 4.44% | 40.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1000756369 | T -> C | LOC_Os10g02180.1 | upstream_gene_variant ; 4665.0bp to feature; MODIFIER | silent_mutation | Average:13.109; most accessible tissue: Zhenshan97 panicle, score: 20.424 | N | N | N | N |
| vg1000756369 | T -> C | LOC_Os10g02200.1 | upstream_gene_variant ; 1531.0bp to feature; MODIFIER | silent_mutation | Average:13.109; most accessible tissue: Zhenshan97 panicle, score: 20.424 | N | N | N | N |
| vg1000756369 | T -> C | LOC_Os10g02190.1 | downstream_gene_variant ; 3786.0bp to feature; MODIFIER | silent_mutation | Average:13.109; most accessible tissue: Zhenshan97 panicle, score: 20.424 | N | N | N | N |
| vg1000756369 | T -> C | LOC_Os10g02210.1 | downstream_gene_variant ; 4812.0bp to feature; MODIFIER | silent_mutation | Average:13.109; most accessible tissue: Zhenshan97 panicle, score: 20.424 | N | N | N | N |
| vg1000756369 | T -> C | LOC_Os10g02200-LOC_Os10g02210 | intergenic_region ; MODIFIER | silent_mutation | Average:13.109; most accessible tissue: Zhenshan97 panicle, score: 20.424 | N | N | N | N |
| vg1000756369 | T -> DEL | N | N | silent_mutation | Average:13.109; most accessible tissue: Zhenshan97 panicle, score: 20.424 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1000756369 | 2.53E-20 | 2.58E-41 | mr1300 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000756369 | 4.36E-09 | 1.60E-13 | mr1300 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000756369 | 9.08E-24 | 1.00E-61 | mr1310 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000756369 | 7.74E-11 | 2.50E-17 | mr1310 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000756369 | 4.04E-32 | 1.06E-76 | mr1926 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000756369 | 8.00E-12 | 8.43E-20 | mr1926 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000756369 | 2.43E-11 | 3.57E-18 | mr1959 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000756369 | 3.07E-07 | 1.80E-09 | mr1959 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000756369 | 2.25E-06 | NA | mr1203_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000756369 | 6.30E-37 | 1.55E-72 | mr1310_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000756369 | 1.07E-16 | 2.75E-27 | mr1310_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000756369 | 2.45E-18 | 2.26E-30 | mr1959_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000756369 | 3.33E-09 | 2.34E-15 | mr1959_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |