\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1000756369:

Variant ID: vg1000756369 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 756369
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.76, T: 0.24, others allele: 0.00, population size: 97. )

Flanking Sequence (100 bp) in Reference Genome:


CCGTCCACTGTCTTTTCTCTTTATTGTCATTGGAATTTTAAAAATCAAACATAATTACTGTTCGGGTTCATTTTTTTACTTTCTAGAAGTCCCACCAAAC[T/C]
GTCAGGGGCTTTGCTATTGTACTCCTCTATGGCTCGTCCGCTGCCTCCCTTCTTTATTGTCATTGAGATTTTAAAATCGACCATGATTATCATTGTTTTT

Reverse complement sequence

AAAAACAATGATAATCATGGTCGATTTTAAAATCTCAATGACAATAAAGAAGGGAGGCAGCGGACGAGCCATAGAGGAGTACAATAGCAAAGCCCCTGAC[A/G]
GTTTGGTGGGACTTCTAGAAAGTAAAAAAATGAACCCGAACAGTAATTATGTTTGATTTTTAAAATTCCAATGACAATAAAGAGAAAAGACAGTGGACGG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 42.10% 16.60% 0.74% 40.56% NA
All Indica  2759 53.30% 0.70% 0.69% 45.31% NA
All Japonica  1512 8.70% 48.70% 0.79% 41.73% NA
Aus  269 98.90% 1.10% 0.00% 0.00% NA
Indica I  595 63.00% 0.70% 0.00% 36.30% NA
Indica II  465 24.90% 0.90% 0.86% 73.33% NA
Indica III  913 55.80% 0.50% 1.42% 42.28% NA
Indica Intermediate  786 59.90% 0.80% 0.25% 39.06% NA
Temperate Japonica  767 9.90% 78.40% 0.00% 11.73% NA
Tropical Japonica  504 4.20% 5.60% 2.38% 87.90% NA
Japonica Intermediate  241 14.50% 44.80% 0.00% 40.66% NA
VI/Aromatic  96 93.80% 6.20% 0.00% 0.00% NA
Intermediate  90 35.60% 20.00% 4.44% 40.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1000756369 T -> C LOC_Os10g02180.1 upstream_gene_variant ; 4665.0bp to feature; MODIFIER silent_mutation Average:13.109; most accessible tissue: Zhenshan97 panicle, score: 20.424 N N N N
vg1000756369 T -> C LOC_Os10g02200.1 upstream_gene_variant ; 1531.0bp to feature; MODIFIER silent_mutation Average:13.109; most accessible tissue: Zhenshan97 panicle, score: 20.424 N N N N
vg1000756369 T -> C LOC_Os10g02190.1 downstream_gene_variant ; 3786.0bp to feature; MODIFIER silent_mutation Average:13.109; most accessible tissue: Zhenshan97 panicle, score: 20.424 N N N N
vg1000756369 T -> C LOC_Os10g02210.1 downstream_gene_variant ; 4812.0bp to feature; MODIFIER silent_mutation Average:13.109; most accessible tissue: Zhenshan97 panicle, score: 20.424 N N N N
vg1000756369 T -> C LOC_Os10g02200-LOC_Os10g02210 intergenic_region ; MODIFIER silent_mutation Average:13.109; most accessible tissue: Zhenshan97 panicle, score: 20.424 N N N N
vg1000756369 T -> DEL N N silent_mutation Average:13.109; most accessible tissue: Zhenshan97 panicle, score: 20.424 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1000756369 2.53E-20 2.58E-41 mr1300 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000756369 4.36E-09 1.60E-13 mr1300 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000756369 9.08E-24 1.00E-61 mr1310 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000756369 7.74E-11 2.50E-17 mr1310 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000756369 4.04E-32 1.06E-76 mr1926 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000756369 8.00E-12 8.43E-20 mr1926 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000756369 2.43E-11 3.57E-18 mr1959 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000756369 3.07E-07 1.80E-09 mr1959 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000756369 2.25E-06 NA mr1203_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000756369 6.30E-37 1.55E-72 mr1310_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000756369 1.07E-16 2.75E-27 mr1310_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000756369 2.45E-18 2.26E-30 mr1959_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000756369 3.33E-09 2.34E-15 mr1959_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251