\
| Variant ID: vg1000754147 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 754147 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.69, A: 0.31, others allele: 0.00, population size: 101. )
TGATAACTCGACGAATTACATAAACAAGATTAGAGTGTCATAAAGATGGAAGCACTAATCCCAAGAACGCAAGCCGTCATAACAAGTTTTACCTCTTGTT[A/G]
AAGATCAAAACCGATGCAGCTCAACCCGAAAGCAAGAACTCGTCGAAATAAAACTAAAGTGAAAGGGTGGCGATGCGCCGAAATTGTATTGAACGTGTGT
ACACACGTTCAATACAATTTCGGCGCATCGCCACCCTTTCACTTTAGTTTTATTTCGACGAGTTCTTGCTTTCGGGTTGAGCTGCATCGGTTTTGATCTT[T/C]
AACAAGAGGTAAAACTTGTTATGACGGCTTGCGTTCTTGGGATTAGTGCTTCCATCTTTATGACACTCTAATCTTGTTTATGTAATTCGTCGAGTTATCA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 42.80% | 16.60% | 4.04% | 36.54% | NA |
| All Indica | 2759 | 54.40% | 0.80% | 6.71% | 38.09% | NA |
| All Japonica | 1512 | 8.70% | 48.80% | 0.20% | 42.33% | NA |
| Aus | 269 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 64.20% | 1.00% | 2.02% | 32.77% | NA |
| Indica II | 465 | 27.30% | 1.30% | 6.45% | 64.95% | NA |
| Indica III | 913 | 56.80% | 0.20% | 9.97% | 32.97% | NA |
| Indica Intermediate | 786 | 60.20% | 1.00% | 6.62% | 32.19% | NA |
| Temperate Japonica | 767 | 9.90% | 78.20% | 0.26% | 11.60% | NA |
| Tropical Japonica | 504 | 3.60% | 6.00% | 0.20% | 90.28% | NA |
| Japonica Intermediate | 241 | 15.40% | 44.80% | 0.00% | 39.83% | NA |
| VI/Aromatic | 96 | 93.80% | 6.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 40.00% | 16.70% | 3.33% | 40.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1000754147 | A -> G | LOC_Os10g02180.1 | upstream_gene_variant ; 2443.0bp to feature; MODIFIER | silent_mutation | Average:16.718; most accessible tissue: Zhenshan97 root, score: 38.035 | N | N | N | N |
| vg1000754147 | A -> G | LOC_Os10g02190.1 | downstream_gene_variant ; 1564.0bp to feature; MODIFIER | silent_mutation | Average:16.718; most accessible tissue: Zhenshan97 root, score: 38.035 | N | N | N | N |
| vg1000754147 | A -> G | LOC_Os10g02200.1 | downstream_gene_variant ; 145.0bp to feature; MODIFIER | silent_mutation | Average:16.718; most accessible tissue: Zhenshan97 root, score: 38.035 | N | N | N | N |
| vg1000754147 | A -> G | LOC_Os10g02190-LOC_Os10g02200 | intergenic_region ; MODIFIER | silent_mutation | Average:16.718; most accessible tissue: Zhenshan97 root, score: 38.035 | N | N | N | N |
| vg1000754147 | A -> DEL | N | N | silent_mutation | Average:16.718; most accessible tissue: Zhenshan97 root, score: 38.035 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1000754147 | 1.31E-07 | NA | mr1310 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000754147 | NA | 4.82E-07 | mr1369 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000754147 | NA | 4.11E-07 | mr1453 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000754147 | NA | 8.11E-12 | mr1498 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000754147 | NA | 3.13E-08 | mr1757 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000754147 | 6.15E-08 | NA | mr1926 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000754147 | 7.98E-07 | NA | mr1926 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000754147 | NA | 1.77E-08 | mr1951 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000754147 | 4.58E-06 | NA | mr1959 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000754147 | NA | 2.64E-06 | mr1968 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000754147 | 2.00E-08 | NA | mr1310_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000754147 | 3.51E-09 | NA | mr1310_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000754147 | NA | 4.44E-06 | mr1549_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000754147 | NA | 3.72E-06 | mr1951_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000754147 | 7.46E-06 | NA | mr1959_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000754147 | NA | 2.65E-06 | mr1968_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |