\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1000754147:

Variant ID: vg1000754147 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 754147
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.69, A: 0.31, others allele: 0.00, population size: 101. )

Flanking Sequence (100 bp) in Reference Genome:


TGATAACTCGACGAATTACATAAACAAGATTAGAGTGTCATAAAGATGGAAGCACTAATCCCAAGAACGCAAGCCGTCATAACAAGTTTTACCTCTTGTT[A/G]
AAGATCAAAACCGATGCAGCTCAACCCGAAAGCAAGAACTCGTCGAAATAAAACTAAAGTGAAAGGGTGGCGATGCGCCGAAATTGTATTGAACGTGTGT

Reverse complement sequence

ACACACGTTCAATACAATTTCGGCGCATCGCCACCCTTTCACTTTAGTTTTATTTCGACGAGTTCTTGCTTTCGGGTTGAGCTGCATCGGTTTTGATCTT[T/C]
AACAAGAGGTAAAACTTGTTATGACGGCTTGCGTTCTTGGGATTAGTGCTTCCATCTTTATGACACTCTAATCTTGTTTATGTAATTCGTCGAGTTATCA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 42.80% 16.60% 4.04% 36.54% NA
All Indica  2759 54.40% 0.80% 6.71% 38.09% NA
All Japonica  1512 8.70% 48.80% 0.20% 42.33% NA
Aus  269 99.30% 0.70% 0.00% 0.00% NA
Indica I  595 64.20% 1.00% 2.02% 32.77% NA
Indica II  465 27.30% 1.30% 6.45% 64.95% NA
Indica III  913 56.80% 0.20% 9.97% 32.97% NA
Indica Intermediate  786 60.20% 1.00% 6.62% 32.19% NA
Temperate Japonica  767 9.90% 78.20% 0.26% 11.60% NA
Tropical Japonica  504 3.60% 6.00% 0.20% 90.28% NA
Japonica Intermediate  241 15.40% 44.80% 0.00% 39.83% NA
VI/Aromatic  96 93.80% 6.20% 0.00% 0.00% NA
Intermediate  90 40.00% 16.70% 3.33% 40.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1000754147 A -> G LOC_Os10g02180.1 upstream_gene_variant ; 2443.0bp to feature; MODIFIER silent_mutation Average:16.718; most accessible tissue: Zhenshan97 root, score: 38.035 N N N N
vg1000754147 A -> G LOC_Os10g02190.1 downstream_gene_variant ; 1564.0bp to feature; MODIFIER silent_mutation Average:16.718; most accessible tissue: Zhenshan97 root, score: 38.035 N N N N
vg1000754147 A -> G LOC_Os10g02200.1 downstream_gene_variant ; 145.0bp to feature; MODIFIER silent_mutation Average:16.718; most accessible tissue: Zhenshan97 root, score: 38.035 N N N N
vg1000754147 A -> G LOC_Os10g02190-LOC_Os10g02200 intergenic_region ; MODIFIER silent_mutation Average:16.718; most accessible tissue: Zhenshan97 root, score: 38.035 N N N N
vg1000754147 A -> DEL N N silent_mutation Average:16.718; most accessible tissue: Zhenshan97 root, score: 38.035 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1000754147 1.31E-07 NA mr1310 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000754147 NA 4.82E-07 mr1369 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000754147 NA 4.11E-07 mr1453 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000754147 NA 8.11E-12 mr1498 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000754147 NA 3.13E-08 mr1757 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000754147 6.15E-08 NA mr1926 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000754147 7.98E-07 NA mr1926 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000754147 NA 1.77E-08 mr1951 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000754147 4.58E-06 NA mr1959 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000754147 NA 2.64E-06 mr1968 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000754147 2.00E-08 NA mr1310_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000754147 3.51E-09 NA mr1310_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000754147 NA 4.44E-06 mr1549_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000754147 NA 3.72E-06 mr1951_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000754147 7.46E-06 NA mr1959_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000754147 NA 2.65E-06 mr1968_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251