\
| Variant ID: vg1000741800 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 741800 |
| Reference Allele: T | Alternative Allele: G |
| Primary Allele: T | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
GGCGGCCATTCAGATGGTCATGGAGATCGCCGGTGCCGCGAGGTTGAGGGGTAGCTCATCTCGGCGACGTCCGCTGCTTCGGTGGTTCGCCGTCGGCACC[T/G]
TCAGCTGTTGGTCGTTCTGGTTGTGCTCTGGTAGCAGCTTCCTCGAACGCATTACTGAGATTGGCTACCGATTCCCGTAGTCGTTCTGTCCAACGTGCGA
TCGCACGTTGGACAGAACGACTACGGGAATCGGTAGCCAATCTCAGTAATGCGTTCGAGGAAGCTGCTACCAGAGCACAACCAGAACGACCAACAGCTGA[A/C]
GGTGCCGACGGCGAACCACCGAAGCAGCGGACGTCGCCGAGATGAGCTACCCCTCAACCTCGCGGCACCGGCGATCTCCATGACCATCTGAATGGCCGCC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 53.90% | 6.40% | 1.78% | 37.98% | NA |
| All Indica | 2759 | 54.40% | 1.50% | 2.14% | 41.97% | NA |
| All Japonica | 1512 | 53.30% | 5.40% | 1.19% | 40.15% | NA |
| Aus | 269 | 53.90% | 46.10% | 0.00% | 0.00% | NA |
| Indica I | 595 | 67.70% | 0.00% | 0.67% | 31.60% | NA |
| Indica II | 465 | 28.40% | 0.00% | 5.16% | 66.45% | NA |
| Indica III | 913 | 53.00% | 3.30% | 1.10% | 42.61% | NA |
| Indica Intermediate | 786 | 61.30% | 1.40% | 2.67% | 34.61% | NA |
| Temperate Japonica | 767 | 79.40% | 9.10% | 0.39% | 11.08% | NA |
| Tropical Japonica | 504 | 12.30% | 0.00% | 2.78% | 84.92% | NA |
| Japonica Intermediate | 241 | 56.00% | 4.60% | 0.41% | 39.00% | NA |
| VI/Aromatic | 96 | 56.20% | 43.80% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 43.30% | 15.60% | 7.78% | 33.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1000741800 | T -> G | LOC_Os10g02170.1 | missense_variant&splice_region_variant ; p.Glu236Asp; MODERATE | nonsynonymous_codon ; E236D | Average:28.866; most accessible tissue: Zhenshan97 flag leaf, score: 63.101 | unknown | unknown | TOLERATED | 0.67 |
| vg1000741800 | T -> DEL | LOC_Os10g02170.1 | N | frameshift_variant | Average:28.866; most accessible tissue: Zhenshan97 flag leaf, score: 63.101 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1000741800 | NA | 4.06E-06 | mr1006 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000741800 | NA | 2.71E-06 | mr1052 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000741800 | NA | 4.52E-08 | mr1757 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000741800 | 9.35E-10 | NA | mr1310_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000741800 | 1.01E-08 | NA | mr1310_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000741800 | NA | 8.73E-08 | mr1549_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000741800 | NA | 3.07E-06 | mr1757_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |