RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg1000740409:

Variant ID: vg1000740409 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 740409
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.84, T: 0.16, others allele: 0.00, population size: 93. )

Flanking Sequence (100 bp) in Reference Genome:

TCAGACCACTTCATCTTGGGTGCAGCCCCCTGCCATGTCGAACAAACCTCACGTTCCACTTTTTTGTATTCTCGCTTTGAAGAGTACACTATGGAGCCTC[T/C]
GAAGATGTGCGAGACATGAAGATCGGAATCTGGGTATGTGAAGTCCGAATCCTGAGTGGTTGCCTCAGTGGCCTTCTCGACTACACGTACTTGCTTGCCC

Reverse complement sequence

GGGCAAGCAAGTACGTGTAGTCGAGAAGGCCACTGAGGCAACCACTCAGGATTCGGACTTCACATACCCAGATTCCGATCTTCATGTCTCGCACATCTTC[A/G]
GAGGCTCCATAGTGTACTCTTCAAAGCGAGAATACAAAAAAGTGGAACGTGAGGTTTGTTCGACATGGCAGGGGGCTGCACCCAAGATGAAGTGGTCTGA

Allele Frequencies:

Search:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	42.10%	16.60%	0.87%	40.48%	NA
All Indica	2759	53.00%	0.80%	1.16%	44.98%	NA
All Japonica	1512	8.90%	48.60%	0.46%	42.00%	NA
Aus	269	99.30%	0.70%	0.00%	0.00%	NA
Indica I	595	63.00%	1.00%	1.51%	34.45%	NA
Indica II	465	25.40%	0.90%	1.51%	72.26%	NA
Indica III	913	55.00%	0.20%	0.44%	44.36%	NA
Indica Intermediate	786	59.50%	1.40%	1.53%	37.53%	NA
Temperate Japonica	767	10.40%	78.00%	0.65%	10.95%	NA
Tropical Japonica	504	3.80%	5.80%	0.40%	90.08%	NA
Japonica Intermediate	241	14.90%	44.80%	0.00%	40.25%	NA
VI/Aromatic	96	93.80%	6.20%	0.00%	0.00%	NA
Intermediate	90	36.70%	20.00%	2.22%	41.11%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1000740409	T -> C	LOC_Os10g02170.1	missense_variant ; p.Arg305Gly; MODERATE	nonsynonymous_codon ; R305E	Average:22.455; most accessible tissue: Zhenshan97 flag leaf, score: 66.327	benign	-0.427	TOLERATED	0.22
vg1000740409	T -> C	LOC_Os10g02170.1	missense_variant ; p.Arg305Gly; MODERATE	nonsynonymous_codon ; R305G	Average:22.455; most accessible tissue: Zhenshan97 flag leaf, score: 66.327	benign	-0.339	TOLERATED	1.00
vg1000740409	T -> DEL	LOC_Os10g02170.1	N	frameshift_variant	Average:22.455; most accessible tissue: Zhenshan97 flag leaf, score: 66.327	N	N	N	N

Showing 1 to 3 of 3 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1000740409	6.38E-06	NA	mr1310	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000740409	NA	1.68E-08	mr1498	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000740409	1.78E-06	NA	mr1926	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000740409	3.91E-07	NA	mr1926	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000740409	4.20E-10	NA	mr1310_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000740409	3.80E-09	NA	mr1310_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000740409	2.78E-08	NA	mr1959_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 7 of 7 entries

Previous1Next

Search for Variation information by Variation ID:

Detailed information for vg1000740409:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact