\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1000739000:

Variant ID: vg1000739000 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 739000
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTTCTATTCCTCTGCCAGAGACGAGGAACCCAAGCAGTTTGCCCGACGGTACCCCGAACGTGCACTTCTCAAGGTTGAGCATGAGGCGATATCGTCTGAG[G/A]
TTGTCGAAGGTTTCCCATAGATCGTCAATCAATGAGTCACTTGTCTTGGTCTTGACAATGATGTCATCGACGTAGGTCTCAACATTGTTACCCAGCTGAT

Reverse complement sequence

ATCAGCTGGGTAACAATGTTGAGACCTACGTCGATGACATCATTGTCAAGACCAAGACAAGTGACTCATTGATTGACGATCTATGGGAAACCTTCGACAA[C/T]
CTCAGACGATATCGCCTCATGCTCAACCTTGAGAAGTGCACGTTCGGGGTACCGTCGGGCAAACTGCTTGGGTTCCTCGTCTCTGGCAGAGGAATAGAAG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 60.10% 12.10% 7.70% 20.12% NA
All Indica  2759 56.00% 6.60% 5.58% 31.82% NA
All Japonica  1512 58.10% 24.70% 13.36% 3.84% NA
Aus  269 99.30% 0.40% 0.37% 0.00% NA
Indica I  595 67.60% 3.40% 3.19% 25.88% NA
Indica II  465 29.00% 9.00% 5.59% 56.34% NA
Indica III  913 56.10% 8.40% 7.23% 28.26% NA
Indica Intermediate  786 63.00% 5.60% 5.47% 25.95% NA
Temperate Japonica  767 88.50% 3.30% 6.13% 2.09% NA
Tropical Japonica  504 11.10% 60.30% 22.62% 5.95% NA
Japonica Intermediate  241 59.30% 18.70% 17.01% 4.98% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 60.00% 15.60% 7.78% 16.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1000739000 G -> A LOC_Os10g02160.1 synonymous_variant ; p.Asn77Asn; LOW synonymous_codon Average:23.152; most accessible tissue: Zhenshan97 flag leaf, score: 49.845 N N N N
vg1000739000 G -> DEL LOC_Os10g02160.1 N frameshift_variant Average:23.152; most accessible tissue: Zhenshan97 flag leaf, score: 49.845 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1000739000 NA 1.62E-06 mr1063 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000739000 NA 1.78E-10 mr1090 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000739000 NA 8.56E-06 mr1192 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000739000 NA 5.89E-09 mr1194 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000739000 7.01E-06 9.39E-12 mr1211 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000739000 NA 8.71E-07 mr1310 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000739000 NA 2.51E-09 mr1539 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000739000 NA 3.12E-12 mr1540 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000739000 NA 2.70E-12 mr1580 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000739000 NA 1.00E-06 mr1627 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000739000 NA 8.05E-08 mr1715 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000739000 NA 1.49E-07 mr1723 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000739000 NA 3.70E-07 mr1729 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000739000 NA 5.22E-09 mr1825 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000739000 NA 2.06E-06 mr1906 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000739000 NA 3.80E-06 mr1960 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000739000 7.88E-06 NA mr1968 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000739000 NA 3.05E-06 mr1968 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000739000 NA 1.28E-07 mr1090_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000739000 NA 4.62E-09 mr1211_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000739000 NA 3.31E-07 mr1233_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000739000 NA 2.88E-09 mr1949_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251