\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1000738859:

Variant ID: vg1000738859 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 738859
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 245. )

Flanking Sequence (100 bp) in Reference Genome:


GTGCAAAGAAGGGCTGTCCTCATTCTCCCATCCTAGTGACGAACCCACTTAGCGCCACCATGCATCCGGTTAGCCTCTGTACTTCCTTGAGTCTTGTGGG[T/C]
GACTTCATATTCTCGATTGCCTTGATCTTCTCGGGATTTGCTTCTATTCCTCTGCCAGAGACGAGGAACCCAAGCAGTTTGCCCGACGGTACCCCGAACG

Reverse complement sequence

CGTTCGGGGTACCGTCGGGCAAACTGCTTGGGTTCCTCGTCTCTGGCAGAGGAATAGAAGCAAATCCCGAGAAGATCAAGGCAATCGAGAATATGAAGTC[A/G]
CCCACAAGACTCAAGGAAGTACAGAGGCTAACCGGATGCATGGTGGCGCTAAGTGGGTTCGTCACTAGGATGGGAGAATGAGGACAGCCCTTCTTTGCAC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 42.20% 36.70% 0.66% 20.42% NA
All Indica  2759 53.40% 12.80% 0.91% 32.91% NA
All Japonica  1512 8.70% 88.20% 0.26% 2.84% NA
Aus  269 99.30% 0.70% 0.00% 0.00% NA
Indica I  595 64.20% 7.40% 2.02% 26.39% NA
Indica II  465 24.70% 16.30% 0.86% 58.06% NA
Indica III  913 55.00% 15.80% 0.33% 28.92% NA
Indica Intermediate  786 60.20% 11.50% 0.76% 27.61% NA
Temperate Japonica  767 10.20% 86.80% 0.13% 2.87% NA
Tropical Japonica  504 3.80% 93.50% 0.60% 2.18% NA
Japonica Intermediate  241 14.50% 81.30% 0.00% 4.15% NA
VI/Aromatic  96 93.80% 6.20% 0.00% 0.00% NA
Intermediate  90 37.80% 44.40% 2.22% 15.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1000738859 T -> C LOC_Os10g02160.1 synonymous_variant ; p.Ser124Ser; LOW synonymous_codon Average:19.279; most accessible tissue: Zhenshan97 flag leaf, score: 50.663 N N N N
vg1000738859 T -> DEL LOC_Os10g02160.1 N frameshift_variant Average:19.279; most accessible tissue: Zhenshan97 flag leaf, score: 50.663 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1000738859 1.28E-08 1.72E-21 mr1300 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000738859 1.22E-06 4.58E-06 mr1300 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000738859 1.19E-09 NA mr1310 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000738859 NA 2.37E-09 mr1806 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000738859 6.23E-17 3.31E-41 mr1926 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000738859 8.73E-09 1.19E-07 mr1926 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000738859 1.36E-06 1.01E-10 mr1959 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000738859 NA 2.36E-06 mr1968 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000738859 NA 5.44E-08 mr1205_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000738859 1.44E-21 1.81E-41 mr1310_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000738859 2.01E-11 5.99E-11 mr1310_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000738859 NA 2.82E-07 mr1668_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000738859 2.47E-06 NA mr1671_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000738859 1.61E-11 9.42E-19 mr1959_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000738859 8.81E-06 1.08E-06 mr1959_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000738859 NA 5.79E-06 mr1968_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251