\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1000738531:

Variant ID: vg1000738531 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 738531
Reference Allele: AAlternative Allele: T
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.81, A: 0.18, C: 0.01, others allele: 0.00, population size: 93. )

Flanking Sequence (100 bp) in Reference Genome:


GAGACAATTGTGACCCTTTGGGCTTGGAAGTAGTGGCGTAGCTTTCTTGACGTCATGATTACGGCGTAGAGCAGTTTTTGGATCTGTTGGTATCTTGTCT[A/T]
TGCGTCGTGTAGAGCTTCGCTGACGTAATAGACTGGTCTCTGCACCTTTTCTCTTTCGAAAATAATGACAGTACTCACAGAGTAGGGCATGGCGGCGATA

Reverse complement sequence

TATCGCCGCCATGCCCTACTCTGTGAGTACTGTCATTATTTTCGAAAGAGAAAAGGTGCAGAGACCAGTCTATTACGTCAGCGAAGCTCTACACGACGCA[T/A]
AGACAAGATACCAACAGATCCAAAAACTGCTCTACGCCGTAATCATGACGTCAAGAAAGCTACGCCACTACTTCCAAGCCCAAAGGGTCACAATTGTCTC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 40.10% 19.50% 2.54% 37.83% NA
All Indica  2759 52.20% 2.40% 1.81% 43.60% NA
All Japonica  1512 8.50% 50.50% 4.56% 36.44% NA
Aus  269 94.80% 5.20% 0.00% 0.00% NA
Indica I  595 63.50% 1.30% 2.52% 32.61% NA
Indica II  465 24.70% 1.70% 3.66% 69.89% NA
Indica III  913 52.10% 3.50% 0.66% 43.70% NA
Indica Intermediate  786 59.80% 2.40% 1.53% 36.26% NA
Temperate Japonica  767 10.30% 78.40% 2.22% 9.13% NA
Tropical Japonica  504 3.80% 9.90% 6.75% 79.56% NA
Japonica Intermediate  241 12.40% 46.90% 7.47% 33.20% NA
VI/Aromatic  96 50.00% 50.00% 0.00% 0.00% NA
Intermediate  90 27.80% 33.30% 1.11% 37.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1000738531 A -> T LOC_Os10g02150.1 downstream_gene_variant ; 2615.0bp to feature; MODIFIER silent_mutation Average:20.59; most accessible tissue: Zhenshan97 flag leaf, score: 52.255 N N N N
vg1000738531 A -> T LOC_Os10g02170.1 downstream_gene_variant ; 1126.0bp to feature; MODIFIER silent_mutation Average:20.59; most accessible tissue: Zhenshan97 flag leaf, score: 52.255 N N N N
vg1000738531 A -> T LOC_Os10g02160.1 intron_variant ; MODIFIER silent_mutation Average:20.59; most accessible tissue: Zhenshan97 flag leaf, score: 52.255 N N N N
vg1000738531 A -> DEL N N silent_mutation Average:20.59; most accessible tissue: Zhenshan97 flag leaf, score: 52.255 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1000738531 6.04E-12 2.53E-27 mr1300 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000738531 4.97E-07 4.65E-09 mr1300 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000738531 1.84E-12 1.08E-38 mr1310 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000738531 7.35E-07 2.54E-09 mr1310 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000738531 NA 4.90E-07 mr1498 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000738531 3.68E-18 3.66E-47 mr1926 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000738531 1.39E-09 1.31E-12 mr1926 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000738531 7.33E-10 2.99E-15 mr1959 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000738531 3.45E-06 2.01E-07 mr1959 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000738531 2.31E-22 2.12E-46 mr1310_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000738531 8.14E-15 7.47E-20 mr1310_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000738531 2.63E-06 2.63E-06 mr1581_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000738531 3.65E-15 6.29E-24 mr1959_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000738531 3.05E-09 1.94E-13 mr1959_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251