\
| Variant ID: vg1000738531 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 738531 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.81, A: 0.18, C: 0.01, others allele: 0.00, population size: 93. )
GAGACAATTGTGACCCTTTGGGCTTGGAAGTAGTGGCGTAGCTTTCTTGACGTCATGATTACGGCGTAGAGCAGTTTTTGGATCTGTTGGTATCTTGTCT[A/T]
TGCGTCGTGTAGAGCTTCGCTGACGTAATAGACTGGTCTCTGCACCTTTTCTCTTTCGAAAATAATGACAGTACTCACAGAGTAGGGCATGGCGGCGATA
TATCGCCGCCATGCCCTACTCTGTGAGTACTGTCATTATTTTCGAAAGAGAAAAGGTGCAGAGACCAGTCTATTACGTCAGCGAAGCTCTACACGACGCA[T/A]
AGACAAGATACCAACAGATCCAAAAACTGCTCTACGCCGTAATCATGACGTCAAGAAAGCTACGCCACTACTTCCAAGCCCAAAGGGTCACAATTGTCTC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 40.10% | 19.50% | 2.54% | 37.83% | NA |
| All Indica | 2759 | 52.20% | 2.40% | 1.81% | 43.60% | NA |
| All Japonica | 1512 | 8.50% | 50.50% | 4.56% | 36.44% | NA |
| Aus | 269 | 94.80% | 5.20% | 0.00% | 0.00% | NA |
| Indica I | 595 | 63.50% | 1.30% | 2.52% | 32.61% | NA |
| Indica II | 465 | 24.70% | 1.70% | 3.66% | 69.89% | NA |
| Indica III | 913 | 52.10% | 3.50% | 0.66% | 43.70% | NA |
| Indica Intermediate | 786 | 59.80% | 2.40% | 1.53% | 36.26% | NA |
| Temperate Japonica | 767 | 10.30% | 78.40% | 2.22% | 9.13% | NA |
| Tropical Japonica | 504 | 3.80% | 9.90% | 6.75% | 79.56% | NA |
| Japonica Intermediate | 241 | 12.40% | 46.90% | 7.47% | 33.20% | NA |
| VI/Aromatic | 96 | 50.00% | 50.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 27.80% | 33.30% | 1.11% | 37.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1000738531 | A -> T | LOC_Os10g02150.1 | downstream_gene_variant ; 2615.0bp to feature; MODIFIER | silent_mutation | Average:20.59; most accessible tissue: Zhenshan97 flag leaf, score: 52.255 | N | N | N | N |
| vg1000738531 | A -> T | LOC_Os10g02170.1 | downstream_gene_variant ; 1126.0bp to feature; MODIFIER | silent_mutation | Average:20.59; most accessible tissue: Zhenshan97 flag leaf, score: 52.255 | N | N | N | N |
| vg1000738531 | A -> T | LOC_Os10g02160.1 | intron_variant ; MODIFIER | silent_mutation | Average:20.59; most accessible tissue: Zhenshan97 flag leaf, score: 52.255 | N | N | N | N |
| vg1000738531 | A -> DEL | N | N | silent_mutation | Average:20.59; most accessible tissue: Zhenshan97 flag leaf, score: 52.255 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1000738531 | 6.04E-12 | 2.53E-27 | mr1300 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000738531 | 4.97E-07 | 4.65E-09 | mr1300 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000738531 | 1.84E-12 | 1.08E-38 | mr1310 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000738531 | 7.35E-07 | 2.54E-09 | mr1310 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000738531 | NA | 4.90E-07 | mr1498 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000738531 | 3.68E-18 | 3.66E-47 | mr1926 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000738531 | 1.39E-09 | 1.31E-12 | mr1926 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000738531 | 7.33E-10 | 2.99E-15 | mr1959 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000738531 | 3.45E-06 | 2.01E-07 | mr1959 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000738531 | 2.31E-22 | 2.12E-46 | mr1310_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000738531 | 8.14E-15 | 7.47E-20 | mr1310_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000738531 | 2.63E-06 | 2.63E-06 | mr1581_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000738531 | 3.65E-15 | 6.29E-24 | mr1959_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000738531 | 3.05E-09 | 1.94E-13 | mr1959_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |