\
| Variant ID: vg1000738126 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 738126 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 340. )
CCTGGTTTATGACTAGTTCAGAATCCCCTTCATACTCCAAGTGCAGCTGCAGCTCTTATCCCAGCGAGTAGTCCTTCATACTCGGCTGTGTTGTTGGTCG[C/T]
CCTGAAGTTAAGGTGAATTGCATGCTTGAACTGATCTCCCGAAGGTGATGTCAAGATGAACCCCGCACCTGCTCCTTGGCTGTTGAGCGCGCCATCGAAA
TTTCGATGGCGCGCTCAACAGCCAAGGAGCAGGTGCGGGGTTCATCTTGACATCACCTTCGGGAGATCAGTTCAAGCATGCAATTCACCTTAACTTCAGG[G/A]
CGACCAACAACACAGCCGAGTATGAAGGACTACTCGCTGGGATAAGAGCTGCAGCTGCACTTGGAGTATGAAGGGGATTCTGAACTAGTCATAAACCAGG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 66.60% | 5.50% | 4.70% | 23.17% | NA |
| All Indica | 2759 | 61.40% | 1.10% | 3.95% | 33.64% | NA |
| All Japonica | 1512 | 76.80% | 6.50% | 7.14% | 9.59% | NA |
| Aus | 269 | 68.40% | 31.60% | 0.00% | 0.00% | NA |
| Indica I | 595 | 70.80% | 0.00% | 3.53% | 25.71% | NA |
| Indica II | 465 | 39.60% | 0.20% | 7.10% | 53.12% | NA |
| Indica III | 913 | 62.90% | 0.80% | 4.05% | 32.31% | NA |
| Indica Intermediate | 786 | 65.40% | 2.70% | 2.29% | 29.64% | NA |
| Temperate Japonica | 767 | 83.20% | 9.30% | 4.04% | 3.52% | NA |
| Tropical Japonica | 504 | 69.60% | 0.80% | 11.71% | 17.86% | NA |
| Japonica Intermediate | 241 | 71.40% | 9.50% | 7.47% | 11.62% | NA |
| VI/Aromatic | 96 | 55.20% | 44.80% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 63.30% | 6.70% | 5.56% | 24.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1000738126 | C -> T | LOC_Os10g02160.1 | missense_variant ; p.Ala298Thr; MODERATE | nonsynonymous_codon ; A298T | Average:27.251; most accessible tissue: Zhenshan97 flag leaf, score: 60.705 | possibly damaging |
1.794 |
DELETERIOUS | 0.03 |
| vg1000738126 | C -> DEL | LOC_Os10g02160.1 | N | frameshift_variant | Average:27.251; most accessible tissue: Zhenshan97 flag leaf, score: 60.705 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1000738126 | NA | 1.21E-06 | mr1040 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000738126 | 2.52E-07 | NA | mr1310 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000738126 | 4.61E-06 | NA | mr1549 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000738126 | 5.97E-06 | 3.72E-09 | mr1549 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000738126 | NA | 4.47E-06 | mr1550 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000738126 | 5.85E-09 | NA | mr1757 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000738126 | 3.30E-07 | 5.52E-12 | mr1757 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000738126 | 1.26E-08 | NA | mr1926 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000738126 | NA | 1.64E-06 | mr1968 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000738126 | 6.76E-13 | NA | mr1310_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000738126 | 8.28E-10 | NA | mr1310_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000738126 | NA | 1.48E-08 | mr1549_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000738126 | NA | 1.55E-06 | mr1550_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000738126 | NA | 8.51E-07 | mr1567_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000738126 | 9.06E-07 | NA | mr1757_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000738126 | NA | 1.80E-08 | mr1757_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000738126 | 5.12E-07 | NA | mr1959_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000738126 | NA | 1.30E-06 | mr1968_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |