\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1000736288:

Variant ID: vg1000736288 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 736288
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.66, C: 0.34, others allele: 0.00, population size: 85. )

Flanking Sequence (100 bp) in Reference Genome:


CTGACCCTAGCCCCCAGCCGTGAAGTTGGAAAAATCCATTTCCGATTACACGGCTTGGTTAATACGCACGGCGAGAACTCTTACATGACCAGATCTTACA[C/T]
GGTCTTTCGTCTCTGAAGGATTCGACAAGGCCTTATCAGCTCTGGGCGTCCCCAGCCGAAGTTCCCTTAGGTTCCTCGGAGGCCTTGTCAAGACGGCGTA

Reverse complement sequence

TACGCCGTCTTGACAAGGCCTCCGAGGAACCTAAGGGAACTTCGGCTGGGGACGCCCAGAGCTGATAAGGCCTTGTCGAATCCTTCAGAGACGAAAGACC[G/A]
TGTAAGATCTGGTCATGTAAGAGTTCTCGCCGTGCGTATTAACCAAGCCGTGTAATCGGAAATGGATTTTTCCAACTTCACGGCTGGGGGCTAGGGTCAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 47.10% 10.40% 5.01% 37.47% NA
All Indica  2759 51.10% 4.60% 4.89% 39.47% NA
All Japonica  1512 51.10% 7.10% 1.85% 40.01% NA
Aus  269 1.90% 56.50% 25.28% 16.36% NA
Indica I  595 66.40% 0.30% 2.35% 30.92% NA
Indica II  465 27.50% 1.70% 6.24% 64.52% NA
Indica III  913 50.30% 5.90% 7.01% 36.80% NA
Indica Intermediate  786 54.30% 7.90% 3.56% 34.22% NA
Temperate Japonica  767 79.30% 9.40% 1.43% 9.91% NA
Tropical Japonica  504 9.90% 1.00% 1.19% 87.90% NA
Japonica Intermediate  241 47.30% 12.40% 4.56% 35.68% NA
VI/Aromatic  96 9.40% 90.60% 0.00% 0.00% NA
Intermediate  90 35.60% 21.10% 6.67% 36.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1000736288 C -> T LOC_Os10g02150.1 downstream_gene_variant ; 372.0bp to feature; MODIFIER silent_mutation Average:29.707; most accessible tissue: Zhenshan97 flag leaf, score: 71.238 N N N N
vg1000736288 C -> T LOC_Os10g02160.1 downstream_gene_variant ; 364.0bp to feature; MODIFIER silent_mutation Average:29.707; most accessible tissue: Zhenshan97 flag leaf, score: 71.238 N N N N
vg1000736288 C -> T LOC_Os10g02170.1 downstream_gene_variant ; 3369.0bp to feature; MODIFIER silent_mutation Average:29.707; most accessible tissue: Zhenshan97 flag leaf, score: 71.238 N N N N
vg1000736288 C -> T LOC_Os10g02150-LOC_Os10g02160 intergenic_region ; MODIFIER silent_mutation Average:29.707; most accessible tissue: Zhenshan97 flag leaf, score: 71.238 N N N N
vg1000736288 C -> DEL N N silent_mutation Average:29.707; most accessible tissue: Zhenshan97 flag leaf, score: 71.238 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1000736288 NA 7.62E-06 mr1040 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000736288 NA 1.94E-08 mr1549 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000736288 1.25E-06 6.46E-11 mr1757 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000736288 3.27E-06 NA mr1926 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000736288 NA 1.54E-06 mr1968 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000736288 3.13E-09 NA mr1310_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000736288 2.02E-10 NA mr1310_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000736288 NA 1.20E-07 mr1549_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000736288 NA 2.02E-06 mr1550_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000736288 NA 3.50E-08 mr1757_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000736288 6.85E-06 NA mr1959_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000736288 NA 9.22E-07 mr1968_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251