\
| Variant ID: vg1000736230 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 736230 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.01, others allele: 0.00, population size: 232. )
GAACTCATCTCGGAAGATAAAGCTCTTGGACCTTCGACTTGCCTTAGTTGAATAAGCACTGACCCTAGCCCCCAGCCGTGAAGTTGGAAAAATCCATTTC[C/T]
GATTACACGGCTTGGTTAATACGCACGGCGAGAACTCTTACATGACCAGATCTTACACGGTCTTTCGTCTCTGAAGGATTCGACAAGGCCTTATCAGCTC
GAGCTGATAAGGCCTTGTCGAATCCTTCAGAGACGAAAGACCGTGTAAGATCTGGTCATGTAAGAGTTCTCGCCGTGCGTATTAACCAAGCCGTGTAATC[G/A]
GAAATGGATTTTTCCAACTTCACGGCTGGGGGCTAGGGTCAGTGCTTATTCAACTAAGGCAAGTCGAAGGTCCAAGAGCTTTATCTTCCGAGATGAGTTC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 49.90% | 3.90% | 15.64% | 30.55% | NA |
| All Indica | 2759 | 46.80% | 1.90% | 18.88% | 32.44% | NA |
| All Japonica | 1512 | 53.60% | 5.30% | 9.26% | 31.81% | NA |
| Aus | 269 | 41.30% | 18.20% | 24.16% | 16.36% | NA |
| Indica I | 595 | 62.70% | 0.20% | 8.40% | 28.74% | NA |
| Indica II | 465 | 26.50% | 0.40% | 17.63% | 55.48% | NA |
| Indica III | 913 | 46.50% | 1.60% | 25.63% | 26.18% | NA |
| Indica Intermediate | 786 | 47.10% | 4.30% | 19.72% | 28.88% | NA |
| Temperate Japonica | 767 | 79.10% | 9.30% | 3.39% | 8.21% | NA |
| Tropical Japonica | 504 | 13.10% | 0.20% | 16.67% | 70.04% | NA |
| Japonica Intermediate | 241 | 57.30% | 3.30% | 12.45% | 26.97% | NA |
| VI/Aromatic | 96 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 56.70% | 2.20% | 14.44% | 26.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1000736230 | C -> T | LOC_Os10g02150.1 | downstream_gene_variant ; 314.0bp to feature; MODIFIER | silent_mutation | Average:29.726; most accessible tissue: Zhenshan97 flag leaf, score: 71.238 | N | N | N | N |
| vg1000736230 | C -> T | LOC_Os10g02160.1 | downstream_gene_variant ; 422.0bp to feature; MODIFIER | silent_mutation | Average:29.726; most accessible tissue: Zhenshan97 flag leaf, score: 71.238 | N | N | N | N |
| vg1000736230 | C -> T | LOC_Os10g02170.1 | downstream_gene_variant ; 3427.0bp to feature; MODIFIER | silent_mutation | Average:29.726; most accessible tissue: Zhenshan97 flag leaf, score: 71.238 | N | N | N | N |
| vg1000736230 | C -> T | LOC_Os10g02150-LOC_Os10g02160 | intergenic_region ; MODIFIER | silent_mutation | Average:29.726; most accessible tissue: Zhenshan97 flag leaf, score: 71.238 | N | N | N | N |
| vg1000736230 | C -> DEL | N | N | silent_mutation | Average:29.726; most accessible tissue: Zhenshan97 flag leaf, score: 71.238 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1000736230 | 5.63E-06 | 5.63E-06 | mr1343 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000736230 | NA | 4.14E-07 | mr1354 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000736230 | NA | 4.63E-07 | mr1621 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000736230 | NA | 7.18E-09 | mr1757 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000736230 | NA | 9.52E-07 | mr1829 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000736230 | 7.14E-08 | NA | mr1926 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000736230 | 7.31E-06 | NA | mr1926 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000736230 | 2.31E-12 | NA | mr1310_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000736230 | 5.64E-10 | NA | mr1310_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000736230 | NA | 1.35E-07 | mr1354_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000736230 | NA | 2.22E-07 | mr1549_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000736230 | NA | 7.74E-07 | mr1757_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000736230 | NA | 3.94E-07 | mr1829_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000736230 | NA | 6.70E-06 | mr1902_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |