\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1000736230:

Variant ID: vg1000736230 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 736230
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.01, others allele: 0.00, population size: 232. )

Flanking Sequence (100 bp) in Reference Genome:


GAACTCATCTCGGAAGATAAAGCTCTTGGACCTTCGACTTGCCTTAGTTGAATAAGCACTGACCCTAGCCCCCAGCCGTGAAGTTGGAAAAATCCATTTC[C/T]
GATTACACGGCTTGGTTAATACGCACGGCGAGAACTCTTACATGACCAGATCTTACACGGTCTTTCGTCTCTGAAGGATTCGACAAGGCCTTATCAGCTC

Reverse complement sequence

GAGCTGATAAGGCCTTGTCGAATCCTTCAGAGACGAAAGACCGTGTAAGATCTGGTCATGTAAGAGTTCTCGCCGTGCGTATTAACCAAGCCGTGTAATC[G/A]
GAAATGGATTTTTCCAACTTCACGGCTGGGGGCTAGGGTCAGTGCTTATTCAACTAAGGCAAGTCGAAGGTCCAAGAGCTTTATCTTCCGAGATGAGTTC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 49.90% 3.90% 15.64% 30.55% NA
All Indica  2759 46.80% 1.90% 18.88% 32.44% NA
All Japonica  1512 53.60% 5.30% 9.26% 31.81% NA
Aus  269 41.30% 18.20% 24.16% 16.36% NA
Indica I  595 62.70% 0.20% 8.40% 28.74% NA
Indica II  465 26.50% 0.40% 17.63% 55.48% NA
Indica III  913 46.50% 1.60% 25.63% 26.18% NA
Indica Intermediate  786 47.10% 4.30% 19.72% 28.88% NA
Temperate Japonica  767 79.10% 9.30% 3.39% 8.21% NA
Tropical Japonica  504 13.10% 0.20% 16.67% 70.04% NA
Japonica Intermediate  241 57.30% 3.30% 12.45% 26.97% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 56.70% 2.20% 14.44% 26.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1000736230 C -> T LOC_Os10g02150.1 downstream_gene_variant ; 314.0bp to feature; MODIFIER silent_mutation Average:29.726; most accessible tissue: Zhenshan97 flag leaf, score: 71.238 N N N N
vg1000736230 C -> T LOC_Os10g02160.1 downstream_gene_variant ; 422.0bp to feature; MODIFIER silent_mutation Average:29.726; most accessible tissue: Zhenshan97 flag leaf, score: 71.238 N N N N
vg1000736230 C -> T LOC_Os10g02170.1 downstream_gene_variant ; 3427.0bp to feature; MODIFIER silent_mutation Average:29.726; most accessible tissue: Zhenshan97 flag leaf, score: 71.238 N N N N
vg1000736230 C -> T LOC_Os10g02150-LOC_Os10g02160 intergenic_region ; MODIFIER silent_mutation Average:29.726; most accessible tissue: Zhenshan97 flag leaf, score: 71.238 N N N N
vg1000736230 C -> DEL N N silent_mutation Average:29.726; most accessible tissue: Zhenshan97 flag leaf, score: 71.238 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1000736230 5.63E-06 5.63E-06 mr1343 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000736230 NA 4.14E-07 mr1354 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000736230 NA 4.63E-07 mr1621 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000736230 NA 7.18E-09 mr1757 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000736230 NA 9.52E-07 mr1829 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000736230 7.14E-08 NA mr1926 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000736230 7.31E-06 NA mr1926 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000736230 2.31E-12 NA mr1310_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000736230 5.64E-10 NA mr1310_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000736230 NA 1.35E-07 mr1354_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000736230 NA 2.22E-07 mr1549_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000736230 NA 7.74E-07 mr1757_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000736230 NA 3.94E-07 mr1829_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000736230 NA 6.70E-06 mr1902_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251