Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1000735141:

Variant ID: vg1000735141 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 735141
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 218. )

Flanking Sequence (100 bp) in Reference Genome:

CACCGCTTGTCTGTACCCCTTAACCAATCGCGTTTTTTAAAACTTTTCGTTGGTTCCGACTGCCTTTGTGTGTGCAATCATCACCTTAGTTTTCTTTGGC[G/A]
TTTTGATTCCGGGTAATTAGTTTGTTGTTTGTAGAGATGTCGATGTCGAGGATATCCAGCAGCGCGGGCAGCCTGAATTGCCGGTAGTCGTTCCAGCACT

Reverse complement sequence

AGTGCTGGAACGACTACCGGCAATTCAGGCTGCCCGCGCTGCTGGATATCCTCGACATCGACATCTCTACAAACAACAAACTAATTACCCGGAATCAAAA[C/T]
GCCAAAGAAAACTAAGGTGATGATTGCACACACAAAGGCAGTCGGAACCAACGAAAAGTTTTAAAAAACGCGATTGGTTAAGGGGTACAGACAAGCGGTG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	59.90%	2.90%	11.13%	26.13%	NA
All Indica	2759	55.70%	2.00%	8.92%	33.38%	NA
All Japonica	1512	57.90%	5.00%	17.59%	19.58%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	67.60%	0.70%	3.70%	28.07%	NA
Indica II	465	28.20%	2.40%	12.90%	56.56%	NA
Indica III	913	56.30%	2.60%	11.50%	29.57%	NA
Indica Intermediate	786	62.30%	2.00%	7.51%	28.12%	NA
Temperate Japonica	767	88.40%	1.00%	4.04%	6.52%	NA
Tropical Japonica	504	10.70%	12.10%	38.49%	38.69%	NA
Japonica Intermediate	241	59.30%	2.50%	17.01%	21.16%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	61.10%	3.30%	15.56%	20.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1000735141	G -> A	LOC_Os10g02160.1	downstream_gene_variant ; 1511.0bp to feature; MODIFIER	silent_mutation	Average:26.853; most accessible tissue: Zhenshan97 flag leaf, score: 76.925	N	N	N	N
vg1000735141	G -> A	LOC_Os10g02170.1	downstream_gene_variant ; 4516.0bp to feature; MODIFIER	silent_mutation	Average:26.853; most accessible tissue: Zhenshan97 flag leaf, score: 76.925	N	N	N	N
vg1000735141	G -> A	LOC_Os10g02150.1	intron_variant ; MODIFIER	silent_mutation	Average:26.853; most accessible tissue: Zhenshan97 flag leaf, score: 76.925	N	N	N	N
vg1000735141	G -> DEL	N	N	silent_mutation	Average:26.853; most accessible tissue: Zhenshan97 flag leaf, score: 76.925	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1000735141	NA	1.64E-08	mr1090	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000735141	NA	1.15E-09	mr1211	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000735141	8.00E-06	NA	mr1536	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000735141	1.88E-06	1.03E-09	mr1539	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000735141	NA	3.50E-06	mr1906	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000735141	NA	9.71E-08	mr1090_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000735141	NA	2.56E-09	mr1211_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251