\
| Variant ID: vg1000735141 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 735141 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 218. )
CACCGCTTGTCTGTACCCCTTAACCAATCGCGTTTTTTAAAACTTTTCGTTGGTTCCGACTGCCTTTGTGTGTGCAATCATCACCTTAGTTTTCTTTGGC[G/A]
TTTTGATTCCGGGTAATTAGTTTGTTGTTTGTAGAGATGTCGATGTCGAGGATATCCAGCAGCGCGGGCAGCCTGAATTGCCGGTAGTCGTTCCAGCACT
AGTGCTGGAACGACTACCGGCAATTCAGGCTGCCCGCGCTGCTGGATATCCTCGACATCGACATCTCTACAAACAACAAACTAATTACCCGGAATCAAAA[C/T]
GCCAAAGAAAACTAAGGTGATGATTGCACACACAAAGGCAGTCGGAACCAACGAAAAGTTTTAAAAAACGCGATTGGTTAAGGGGTACAGACAAGCGGTG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 59.90% | 2.90% | 11.13% | 26.13% | NA |
| All Indica | 2759 | 55.70% | 2.00% | 8.92% | 33.38% | NA |
| All Japonica | 1512 | 57.90% | 5.00% | 17.59% | 19.58% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 67.60% | 0.70% | 3.70% | 28.07% | NA |
| Indica II | 465 | 28.20% | 2.40% | 12.90% | 56.56% | NA |
| Indica III | 913 | 56.30% | 2.60% | 11.50% | 29.57% | NA |
| Indica Intermediate | 786 | 62.30% | 2.00% | 7.51% | 28.12% | NA |
| Temperate Japonica | 767 | 88.40% | 1.00% | 4.04% | 6.52% | NA |
| Tropical Japonica | 504 | 10.70% | 12.10% | 38.49% | 38.69% | NA |
| Japonica Intermediate | 241 | 59.30% | 2.50% | 17.01% | 21.16% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 61.10% | 3.30% | 15.56% | 20.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1000735141 | G -> A | LOC_Os10g02160.1 | downstream_gene_variant ; 1511.0bp to feature; MODIFIER | silent_mutation | Average:26.853; most accessible tissue: Zhenshan97 flag leaf, score: 76.925 | N | N | N | N |
| vg1000735141 | G -> A | LOC_Os10g02170.1 | downstream_gene_variant ; 4516.0bp to feature; MODIFIER | silent_mutation | Average:26.853; most accessible tissue: Zhenshan97 flag leaf, score: 76.925 | N | N | N | N |
| vg1000735141 | G -> A | LOC_Os10g02150.1 | intron_variant ; MODIFIER | silent_mutation | Average:26.853; most accessible tissue: Zhenshan97 flag leaf, score: 76.925 | N | N | N | N |
| vg1000735141 | G -> DEL | N | N | silent_mutation | Average:26.853; most accessible tissue: Zhenshan97 flag leaf, score: 76.925 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1000735141 | NA | 1.64E-08 | mr1090 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000735141 | NA | 1.15E-09 | mr1211 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000735141 | 8.00E-06 | NA | mr1536 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000735141 | 1.88E-06 | 1.03E-09 | mr1539 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000735141 | NA | 3.50E-06 | mr1906 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000735141 | NA | 9.71E-08 | mr1090_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000735141 | NA | 2.56E-09 | mr1211_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |