\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1000730968:

Variant ID: vg1000730968 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 730968
Reference Allele: CAlternative Allele: T,A
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 250. )

Flanking Sequence (100 bp) in Reference Genome:


GACTATGATTATTACAAGTAACATATAAACTATTAGTACGGTTCTCTCTACTATAATCTTTCCACGGGATTAAATAAATACGATTCCCTTGGAATACTCT[C/T,A]
GGGTGAAATGCTACAATTGTATATCTGTGCGCTTGCGGATGAACTCTGTAACCACAATATACTAAGAGTATTTCAGCGCCATTGCTGGGAATTAAATTTC

Reverse complement sequence

GAAATTTAATTCCCAGCAATGGCGCTGAAATACTCTTAGTATATTGTGGTTACAGAGTTCATCCGCAAGCGCACAGATATACAATTGTAGCATTTCACCC[G/A,T]
AGAGTATTCCAAGGGAATCGTATTTATTTAATCCCGTGGAAAGATTATAGTAGAGAGAACCGTACTAATAGTTTATATGTTACTTGTAATAATCATAGTC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 95.40% 3.20% 1.35% 0.00% A: 0.04%
All Indica  2759 99.80% 0.10% 0.11% 0.00% NA
All Japonica  1512 86.60% 9.60% 3.84% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 99.60% 0.20% 0.22% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.70% 0.00% 0.25% 0.00% NA
Temperate Japonica  767 82.70% 10.80% 6.52% 0.00% NA
Tropical Japonica  504 97.80% 2.20% 0.00% 0.00% NA
Japonica Intermediate  241 75.50% 21.20% 3.32% 0.00% NA
VI/Aromatic  96 94.80% 3.10% 2.08% 0.00% NA
Intermediate  90 95.60% 1.10% 1.11% 0.00% A: 2.22%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1000730968 C -> T LOC_Os10g02150.1 upstream_gene_variant ; 1981.0bp to feature; MODIFIER silent_mutation Average:43.58; most accessible tissue: Minghui63 young leaf, score: 69.4 N N N N
vg1000730968 C -> T LOC_Os10g02140-LOC_Os10g02150 intergenic_region ; MODIFIER silent_mutation Average:43.58; most accessible tissue: Minghui63 young leaf, score: 69.4 N N N N
vg1000730968 C -> A LOC_Os10g02150.1 upstream_gene_variant ; 1981.0bp to feature; MODIFIER silent_mutation Average:43.58; most accessible tissue: Minghui63 young leaf, score: 69.4 N N N N
vg1000730968 C -> A LOC_Os10g02140-LOC_Os10g02150 intergenic_region ; MODIFIER silent_mutation Average:43.58; most accessible tissue: Minghui63 young leaf, score: 69.4 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1000730968 1.36E-09 NA mr1300 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000730968 NA 5.96E-06 mr1300 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000730968 1.43E-10 NA mr1310 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000730968 6.46E-10 NA mr1926 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000730968 4.80E-07 2.22E-09 mr1959 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000730968 3.06E-12 NA mr1310_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000730968 2.43E-07 NA mr1959_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251