\
| Variant ID: vg1000730968 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 730968 |
| Reference Allele: C | Alternative Allele: T,A |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 250. )
GACTATGATTATTACAAGTAACATATAAACTATTAGTACGGTTCTCTCTACTATAATCTTTCCACGGGATTAAATAAATACGATTCCCTTGGAATACTCT[C/T,A]
GGGTGAAATGCTACAATTGTATATCTGTGCGCTTGCGGATGAACTCTGTAACCACAATATACTAAGAGTATTTCAGCGCCATTGCTGGGAATTAAATTTC
GAAATTTAATTCCCAGCAATGGCGCTGAAATACTCTTAGTATATTGTGGTTACAGAGTTCATCCGCAAGCGCACAGATATACAATTGTAGCATTTCACCC[G/A,T]
AGAGTATTCCAAGGGAATCGTATTTATTTAATCCCGTGGAAAGATTATAGTAGAGAGAACCGTACTAATAGTTTATATGTTACTTGTAATAATCATAGTC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 95.40% | 3.20% | 1.35% | 0.00% | A: 0.04% |
| All Indica | 2759 | 99.80% | 0.10% | 0.11% | 0.00% | NA |
| All Japonica | 1512 | 86.60% | 9.60% | 3.84% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.60% | 0.20% | 0.22% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.70% | 0.00% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 82.70% | 10.80% | 6.52% | 0.00% | NA |
| Tropical Japonica | 504 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 75.50% | 21.20% | 3.32% | 0.00% | NA |
| VI/Aromatic | 96 | 94.80% | 3.10% | 2.08% | 0.00% | NA |
| Intermediate | 90 | 95.60% | 1.10% | 1.11% | 0.00% | A: 2.22% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1000730968 | C -> T | LOC_Os10g02150.1 | upstream_gene_variant ; 1981.0bp to feature; MODIFIER | silent_mutation | Average:43.58; most accessible tissue: Minghui63 young leaf, score: 69.4 | N | N | N | N |
| vg1000730968 | C -> T | LOC_Os10g02140-LOC_Os10g02150 | intergenic_region ; MODIFIER | silent_mutation | Average:43.58; most accessible tissue: Minghui63 young leaf, score: 69.4 | N | N | N | N |
| vg1000730968 | C -> A | LOC_Os10g02150.1 | upstream_gene_variant ; 1981.0bp to feature; MODIFIER | silent_mutation | Average:43.58; most accessible tissue: Minghui63 young leaf, score: 69.4 | N | N | N | N |
| vg1000730968 | C -> A | LOC_Os10g02140-LOC_Os10g02150 | intergenic_region ; MODIFIER | silent_mutation | Average:43.58; most accessible tissue: Minghui63 young leaf, score: 69.4 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1000730968 | 1.36E-09 | NA | mr1300 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000730968 | NA | 5.96E-06 | mr1300 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000730968 | 1.43E-10 | NA | mr1310 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000730968 | 6.46E-10 | NA | mr1926 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000730968 | 4.80E-07 | 2.22E-09 | mr1959 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000730968 | 3.06E-12 | NA | mr1310_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000730968 | 2.43E-07 | NA | mr1959_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |