\
| Variant ID: vg1000709547 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 709547 |
| Reference Allele: C | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
GCCGATCTTATCTGATTTAACTAATTTATATCTTATATGCTTGATTGGCATGTTAAATCCGCCCTTTATGTTAAGATCTTGTTGTGTTTAGGTATATTAA[C/G]
CTTTTTGTTTGATATATCCTACTTGCTTTAATATCTTAATATAGAGTGGTATTGGAGTAATTAGCCGATACATGCTAGATCTATCTGATCGGCTATGCTA
TAGCATAGCCGATCAGATAGATCTAGCATGTATCGGCTAATTACTCCAATACCACTCTATATTAAGATATTAAAGCAAGTAGGATATATCAAACAAAAAG[G/C]
TTAATATACCTAAACACAACAAGATCTTAACATAAAGGGCGGATTTAACATGCCAATCAAGCATATAAGATATAAATTAGTTAAATCAGATAAGATCGGC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 83.50% | 16.50% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 51.00% | 49.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 21.10% | 78.90% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 94.40% | 5.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 55.20% | 44.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 93.80% | 6.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 82.20% | 17.80% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1000709547 | C -> G | LOC_Os10g02120.1 | upstream_gene_variant ; 4320.0bp to feature; MODIFIER | silent_mutation | Average:41.025; most accessible tissue: Zhenshan97 panicle, score: 52.263 | N | N | N | N |
| vg1000709547 | C -> G | LOC_Os10g02120-LOC_Os10g02130 | intergenic_region ; MODIFIER | silent_mutation | Average:41.025; most accessible tissue: Zhenshan97 panicle, score: 52.263 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1000709547 | 1.36E-25 | 1.87E-47 | mr1300 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000709547 | 4.44E-12 | 6.18E-17 | mr1300 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000709547 | 1.97E-29 | 7.02E-70 | mr1310 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000709547 | 1.86E-13 | 1.32E-20 | mr1310 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000709547 | 1.66E-06 | NA | mr1498 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000709547 | 4.33E-39 | 5.44E-86 | mr1926 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000709547 | 2.18E-15 | 1.62E-24 | mr1926 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000709547 | 1.04E-15 | 1.67E-21 | mr1959 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000709547 | 1.08E-09 | 5.37E-12 | mr1959 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000709547 | 3.56E-45 | 4.77E-81 | mr1310_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000709547 | 4.36E-23 | 6.21E-35 | mr1310_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000709547 | 6.36E-06 | 6.36E-06 | mr1581_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000709547 | 1.22E-23 | 4.15E-34 | mr1959_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000709547 | 3.44E-14 | 4.64E-21 | mr1959_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |