\
| Variant ID: vg1000702985 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 702985 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 313. )
TGACCAGTTTCCTCGAGGAAAAACCAGATTTTTGCCACTTTGATTTTGCAAAAGCAATCTCTCTCTCCATTTTCTGTTTATGAGCTAATCTGAAACAAAA[A/G]
CCAACAATATGTCCATCTTTGCCACAAAAAGAACAAGTATATTTTTCACGATGATTAGACACATTGGTAGCACTAGTAGATTTAGCAACATGAGCAACAA
TTGTTGCTCATGTTGCTAAATCTACTAGTGCTACCAATGTGTCTAATCATCGTGAAAAATATACTTGTTCTTTTTGTGGCAAAGATGGACATATTGTTGG[T/C]
TTTTGTTTCAGATTAGCTCATAAACAGAAAATGGAGAGAGAGATTGCTTTTGCAAAATCAAAGTGGCAAAAATCTGGTTTTTCCTCGAGGAAACTGGTCA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 83.00% | 12.90% | 4.13% | 0.00% | NA |
| All Indica | 2759 | 71.30% | 21.60% | 7.03% | 0.00% | NA |
| All Japonica | 1512 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Aus | 269 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 56.80% | 27.70% | 15.46% | 0.00% | NA |
| Indica II | 465 | 83.00% | 13.10% | 3.87% | 0.00% | NA |
| Indica III | 913 | 73.70% | 22.60% | 3.72% | 0.00% | NA |
| Indica Intermediate | 786 | 72.60% | 21.00% | 6.36% | 0.00% | NA |
| Temperate Japonica | 767 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 98.60% | 1.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 96.70% | 2.20% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1000702985 | A -> G | LOC_Os10g02120.1 | intron_variant ; MODIFIER | silent_mutation | Average:46.426; most accessible tissue: Minghui63 young leaf, score: 71.839 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1000702985 | 1.66E-06 | 7.04E-06 | mr1245_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000702985 | 8.77E-06 | 5.84E-06 | mr1245_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000702985 | 3.08E-06 | 2.01E-08 | mr1332_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000702985 | 1.15E-06 | 5.59E-08 | mr1332_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000702985 | 1.89E-06 | 4.39E-06 | mr1373_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000702985 | 9.46E-06 | 1.89E-06 | mr1373_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000702985 | NA | 2.36E-06 | mr1648_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000702985 | NA | 2.31E-06 | mr1648_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000702985 | NA | 2.38E-07 | mr1655_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000702985 | NA | 5.37E-06 | mr1669_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |