\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1000661364:

Variant ID: vg1000661364 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 661364
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACAATGACGGTTCTGTCCACCATCCATTGTGATCCCAAGGATAGCTTCCCGCCATTGGGTCGTTATGGTTTTCTGAGGACGTCCATATTCCCGCCTCTCA[A/G]
GAAGTGGCTCCATCAGCATAAAAATCATCATGCAATATCCCATCCCACACAAGTTAAAGAATTTAGAGTCTAGCCAAGTGTAATACATGTCCCGGTGCTC

Reverse complement sequence

GAGCACCGGGACATGTATTACACTTGGCTAGACTCTAAATTCTTTAACTTGTGTGGGATGGGATATTGCATGATGATTTTTATGCTGATGGAGCCACTTC[T/C]
TGAGAGGCGGGAATATGGACGTCCTCAGAAAACCATAACGACCCAATGGCGGGAAGCTATCCTTGGGATCACAATGGATGGTGGACAGAACCGTCATTGT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 20.40% 1.40% 17.67% 60.50% NA
All Indica  2759 6.50% 0.00% 21.96% 71.58% NA
All Japonica  1512 49.50% 4.40% 1.52% 44.51% NA
Aus  269 2.60% 0.00% 53.16% 44.24% NA
Indica I  595 4.00% 0.00% 11.09% 84.87% NA
Indica II  465 6.00% 0.00% 27.53% 66.45% NA
Indica III  913 5.60% 0.00% 26.62% 67.80% NA
Indica Intermediate  786 9.50% 0.00% 21.50% 68.96% NA
Temperate Japonica  767 79.40% 8.00% 0.52% 12.13% NA
Tropical Japonica  504 6.20% 0.00% 1.79% 92.06% NA
Japonica Intermediate  241 45.20% 2.50% 4.15% 48.13% NA
VI/Aromatic  96 6.20% 0.00% 42.71% 51.04% NA
Intermediate  90 26.70% 1.10% 24.44% 47.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1000661364 A -> G LOC_Os10g02040.2 upstream_gene_variant ; 2457.0bp to feature; MODIFIER silent_mutation Average:8.935; most accessible tissue: Minghui63 root, score: 23.574 N N N N
vg1000661364 A -> G LOC_Os10g02050.1 upstream_gene_variant ; 2254.0bp to feature; MODIFIER silent_mutation Average:8.935; most accessible tissue: Minghui63 root, score: 23.574 N N N N
vg1000661364 A -> G LOC_Os10g02040.1 upstream_gene_variant ; 2457.0bp to feature; MODIFIER silent_mutation Average:8.935; most accessible tissue: Minghui63 root, score: 23.574 N N N N
vg1000661364 A -> G LOC_Os10g02040-LOC_Os10g02050 intergenic_region ; MODIFIER silent_mutation Average:8.935; most accessible tissue: Minghui63 root, score: 23.574 N N N N
vg1000661364 A -> DEL N N silent_mutation Average:8.935; most accessible tissue: Minghui63 root, score: 23.574 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1000661364 4.74E-06 NA mr1300 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000661364 9.12E-10 4.33E-14 mr1300 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000661364 9.09E-06 NA mr1310 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000661364 1.06E-09 5.14E-16 mr1310 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000661364 1.11E-08 NA mr1926 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000661364 1.22E-10 1.66E-18 mr1926 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000661364 1.57E-07 1.03E-09 mr1959 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000661364 8.71E-10 NA mr1310_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000661364 4.12E-15 6.34E-26 mr1310_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000661364 1.17E-09 6.32E-16 mr1959_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251