\
| Variant ID: vg1000661364 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 661364 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
ACAATGACGGTTCTGTCCACCATCCATTGTGATCCCAAGGATAGCTTCCCGCCATTGGGTCGTTATGGTTTTCTGAGGACGTCCATATTCCCGCCTCTCA[A/G]
GAAGTGGCTCCATCAGCATAAAAATCATCATGCAATATCCCATCCCACACAAGTTAAAGAATTTAGAGTCTAGCCAAGTGTAATACATGTCCCGGTGCTC
GAGCACCGGGACATGTATTACACTTGGCTAGACTCTAAATTCTTTAACTTGTGTGGGATGGGATATTGCATGATGATTTTTATGCTGATGGAGCCACTTC[T/C]
TGAGAGGCGGGAATATGGACGTCCTCAGAAAACCATAACGACCCAATGGCGGGAAGCTATCCTTGGGATCACAATGGATGGTGGACAGAACCGTCATTGT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 20.40% | 1.40% | 17.67% | 60.50% | NA |
| All Indica | 2759 | 6.50% | 0.00% | 21.96% | 71.58% | NA |
| All Japonica | 1512 | 49.50% | 4.40% | 1.52% | 44.51% | NA |
| Aus | 269 | 2.60% | 0.00% | 53.16% | 44.24% | NA |
| Indica I | 595 | 4.00% | 0.00% | 11.09% | 84.87% | NA |
| Indica II | 465 | 6.00% | 0.00% | 27.53% | 66.45% | NA |
| Indica III | 913 | 5.60% | 0.00% | 26.62% | 67.80% | NA |
| Indica Intermediate | 786 | 9.50% | 0.00% | 21.50% | 68.96% | NA |
| Temperate Japonica | 767 | 79.40% | 8.00% | 0.52% | 12.13% | NA |
| Tropical Japonica | 504 | 6.20% | 0.00% | 1.79% | 92.06% | NA |
| Japonica Intermediate | 241 | 45.20% | 2.50% | 4.15% | 48.13% | NA |
| VI/Aromatic | 96 | 6.20% | 0.00% | 42.71% | 51.04% | NA |
| Intermediate | 90 | 26.70% | 1.10% | 24.44% | 47.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1000661364 | A -> G | LOC_Os10g02040.2 | upstream_gene_variant ; 2457.0bp to feature; MODIFIER | silent_mutation | Average:8.935; most accessible tissue: Minghui63 root, score: 23.574 | N | N | N | N |
| vg1000661364 | A -> G | LOC_Os10g02050.1 | upstream_gene_variant ; 2254.0bp to feature; MODIFIER | silent_mutation | Average:8.935; most accessible tissue: Minghui63 root, score: 23.574 | N | N | N | N |
| vg1000661364 | A -> G | LOC_Os10g02040.1 | upstream_gene_variant ; 2457.0bp to feature; MODIFIER | silent_mutation | Average:8.935; most accessible tissue: Minghui63 root, score: 23.574 | N | N | N | N |
| vg1000661364 | A -> G | LOC_Os10g02040-LOC_Os10g02050 | intergenic_region ; MODIFIER | silent_mutation | Average:8.935; most accessible tissue: Minghui63 root, score: 23.574 | N | N | N | N |
| vg1000661364 | A -> DEL | N | N | silent_mutation | Average:8.935; most accessible tissue: Minghui63 root, score: 23.574 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1000661364 | 4.74E-06 | NA | mr1300 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000661364 | 9.12E-10 | 4.33E-14 | mr1300 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000661364 | 9.09E-06 | NA | mr1310 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000661364 | 1.06E-09 | 5.14E-16 | mr1310 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000661364 | 1.11E-08 | NA | mr1926 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000661364 | 1.22E-10 | 1.66E-18 | mr1926 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000661364 | 1.57E-07 | 1.03E-09 | mr1959 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000661364 | 8.71E-10 | NA | mr1310_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000661364 | 4.12E-15 | 6.34E-26 | mr1310_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000661364 | 1.17E-09 | 6.32E-16 | mr1959_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |