| Variant ID: vg1000651713 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 651713 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
CGATTTGGTGTTTTATTAACAGTTTTTATATGTCGTATCAACCGCTACCACTCTACTCCTTTATAGTCCTGTTACTTAATTTATCTCGTCATGTGTTTTA[A/G]
ATGGTCTTTTCTTTCAATAGTCTTTATTTTTATCATAAATTTTAGTTATTTATAAATTGTATTCCGAATTGAAATCTTATTTTTATTTTTCTAATTTCAG
CTGAAATTAGAAAAATAAAAATAAGATTTCAATTCGGAATACAATTTATAAATAACTAAAATTTATGATAAAAATAAAGACTATTGAAAGAAAAGACCAT[T/C]
TAAAACACATGACGAGATAAATTAAGTAACAGGACTATAAAGGAGTAGAGTGGTAGCGGTTGATACGACATATAAAAACTGTTAATAAAACACCAAATCG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 79.70% | 18.30% | 0.02% | 1.99% | NA |
| All Indica | 2759 | 98.00% | 0.70% | 0.00% | 1.30% | NA |
| All Japonica | 1512 | 46.00% | 53.70% | 0.00% | 0.33% | NA |
| Aus | 269 | 93.70% | 2.60% | 0.00% | 3.72% | NA |
| Indica I | 595 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.10% | 0.60% | 0.00% | 0.22% | NA |
| Indica III | 913 | 96.40% | 0.20% | 0.00% | 3.40% | NA |
| Indica Intermediate | 786 | 98.50% | 1.00% | 0.00% | 0.51% | NA |
| Temperate Japonica | 767 | 13.00% | 87.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 94.00% | 6.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 50.20% | 47.70% | 0.00% | 2.07% | NA |
| VI/Aromatic | 96 | 52.10% | 8.30% | 0.00% | 39.58% | NA |
| Intermediate | 90 | 73.30% | 20.00% | 1.11% | 5.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1000651713 | A -> G | LOC_Os10g02030.1 | upstream_gene_variant ; 668.0bp to feature; MODIFIER | silent_mutation | Average:21.369; most accessible tissue: Minghui63 young leaf, score: 39.381 | N | N | N | N |
| vg1000651713 | A -> G | LOC_Os10g02040.2 | downstream_gene_variant ; 3899.0bp to feature; MODIFIER | silent_mutation | Average:21.369; most accessible tissue: Minghui63 young leaf, score: 39.381 | N | N | N | N |
| vg1000651713 | A -> G | LOC_Os10g02040.1 | downstream_gene_variant ; 3899.0bp to feature; MODIFIER | silent_mutation | Average:21.369; most accessible tissue: Minghui63 young leaf, score: 39.381 | N | N | N | N |
| vg1000651713 | A -> G | LOC_Os10g02030-LOC_Os10g02040 | intergenic_region ; MODIFIER | silent_mutation | Average:21.369; most accessible tissue: Minghui63 young leaf, score: 39.381 | N | N | N | N |
| vg1000651713 | A -> DEL | N | N | silent_mutation | Average:21.369; most accessible tissue: Minghui63 young leaf, score: 39.381 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1000651713 | 1.40E-06 | 1.40E-06 | mr1011 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000651713 | 3.93E-07 | 3.29E-20 | mr1156 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000651713 | NA | 4.81E-08 | mr1156 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000651713 | NA | 1.80E-08 | mr1163 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000651713 | NA | 9.39E-07 | mr1179 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000651713 | NA | 1.31E-06 | mr1192 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000651713 | NA | 1.45E-06 | mr1252 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000651713 | 5.05E-13 | 2.92E-34 | mr1300 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000651713 | 2.54E-06 | 3.81E-10 | mr1300 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000651713 | 1.70E-11 | 7.37E-50 | mr1310 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/