\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1000651713:

Variant ID: vg1000651713 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 651713
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CGATTTGGTGTTTTATTAACAGTTTTTATATGTCGTATCAACCGCTACCACTCTACTCCTTTATAGTCCTGTTACTTAATTTATCTCGTCATGTGTTTTA[A/G]
ATGGTCTTTTCTTTCAATAGTCTTTATTTTTATCATAAATTTTAGTTATTTATAAATTGTATTCCGAATTGAAATCTTATTTTTATTTTTCTAATTTCAG

Reverse complement sequence

CTGAAATTAGAAAAATAAAAATAAGATTTCAATTCGGAATACAATTTATAAATAACTAAAATTTATGATAAAAATAAAGACTATTGAAAGAAAAGACCAT[T/C]
TAAAACACATGACGAGATAAATTAAGTAACAGGACTATAAAGGAGTAGAGTGGTAGCGGTTGATACGACATATAAAAACTGTTAATAAAACACCAAATCG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 79.70% 18.30% 0.02% 1.99% NA
All Indica  2759 98.00% 0.70% 0.00% 1.30% NA
All Japonica  1512 46.00% 53.70% 0.00% 0.33% NA
Aus  269 93.70% 2.60% 0.00% 3.72% NA
Indica I  595 99.20% 0.80% 0.00% 0.00% NA
Indica II  465 99.10% 0.60% 0.00% 0.22% NA
Indica III  913 96.40% 0.20% 0.00% 3.40% NA
Indica Intermediate  786 98.50% 1.00% 0.00% 0.51% NA
Temperate Japonica  767 13.00% 87.00% 0.00% 0.00% NA
Tropical Japonica  504 94.00% 6.00% 0.00% 0.00% NA
Japonica Intermediate  241 50.20% 47.70% 0.00% 2.07% NA
VI/Aromatic  96 52.10% 8.30% 0.00% 39.58% NA
Intermediate  90 73.30% 20.00% 1.11% 5.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1000651713 A -> G LOC_Os10g02030.1 upstream_gene_variant ; 668.0bp to feature; MODIFIER silent_mutation Average:21.369; most accessible tissue: Minghui63 young leaf, score: 39.381 N N N N
vg1000651713 A -> G LOC_Os10g02040.2 downstream_gene_variant ; 3899.0bp to feature; MODIFIER silent_mutation Average:21.369; most accessible tissue: Minghui63 young leaf, score: 39.381 N N N N
vg1000651713 A -> G LOC_Os10g02040.1 downstream_gene_variant ; 3899.0bp to feature; MODIFIER silent_mutation Average:21.369; most accessible tissue: Minghui63 young leaf, score: 39.381 N N N N
vg1000651713 A -> G LOC_Os10g02030-LOC_Os10g02040 intergenic_region ; MODIFIER silent_mutation Average:21.369; most accessible tissue: Minghui63 young leaf, score: 39.381 N N N N
vg1000651713 A -> DEL N N silent_mutation Average:21.369; most accessible tissue: Minghui63 young leaf, score: 39.381 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1000651713 1.40E-06 1.40E-06 mr1011 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000651713 3.93E-07 3.29E-20 mr1156 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000651713 NA 4.81E-08 mr1156 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000651713 NA 1.80E-08 mr1163 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000651713 NA 9.39E-07 mr1179 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000651713 NA 1.31E-06 mr1192 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000651713 NA 1.45E-06 mr1252 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000651713 5.05E-13 2.92E-34 mr1300 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000651713 2.54E-06 3.81E-10 mr1300 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000651713 1.70E-11 7.37E-50 mr1310 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000651713 2.73E-06 3.53E-12 mr1310 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000651713 NA 4.93E-12 mr1486 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000651713 NA 6.05E-11 mr1539 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000651713 NA 1.93E-08 mr1548 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000651713 NA 3.20E-10 mr1549 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000651713 NA 1.30E-07 mr1570 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000651713 NA 8.62E-10 mr1580 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000651713 NA 5.08E-07 mr1588 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000651713 NA 3.32E-10 mr1624 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000651713 NA 9.04E-09 mr1624 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000651713 NA 3.00E-07 mr1723 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000651713 NA 5.17E-07 mr1729 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000651713 NA 3.22E-07 mr1736 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000651713 NA 7.66E-06 mr1740 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000651713 NA 4.30E-13 mr1741 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000651713 NA 4.92E-09 mr1757 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000651713 NA 7.90E-07 mr1780 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000651713 NA 7.76E-10 mr1825 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000651713 NA 9.59E-07 mr1870 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000651713 NA 4.06E-06 mr1912 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000651713 2.02E-14 8.38E-57 mr1926 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000651713 1.04E-06 1.40E-13 mr1926 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000651713 1.89E-07 3.65E-14 mr1959 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000651713 NA 3.39E-07 mr1959 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000651713 NA 6.33E-18 mr1156_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000651713 1.40E-12 1.93E-48 mr1310_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000651713 3.11E-07 4.77E-15 mr1310_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000651713 NA 1.71E-11 mr1486_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000651713 NA 1.81E-07 mr1563_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000651713 NA 6.04E-06 mr1588_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000651713 NA 2.85E-11 mr1624_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000651713 4.71E-08 1.85E-20 mr1959_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000651713 NA 6.62E-10 mr1959_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251