Search for Variation information by Variation ID:
Detailed information for vg1000647302:
| Variant ID: vg1000647302 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 647302 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
Flanking Sequence (100 bp) in Reference Genome:
GTTACCAGGTTGCTTGGGGCCTTGAATAATAATCGGCATCATTATGTACTTCCTCTTCATACATAGCCTAGGGGGGAGGTTGTAGATACACATCGTAACG[A/G]
GCCAAGTGCTATGGCCGCTGCTCATCTCTCCAAAACGATTCATGCCATCCGTACTTAAACCAAACCGTTTGTTTCGTGCGTCCTTTCCAAAGTCTTTAAA
Reverse complement sequence
TTTAAAGACTTTGGAAAGGACGCACGAAACAAACGGTTTGGTTTAAGTACGGATGGCATGAATCGTTTTGGAGAGATGAGCAGCGGCCATAGCACTTGGC[T/C]
CGTTACGATGTGTATCTACAACCTCCCCCCTAGGCTATGTATGAAGAGGAAGTACATAATGATGCCGATTATTATTCAAGGCCCCAAGCAACCTGGTAAC
Allele Frequencies:
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 17.80% | 1.40% | 10.16% | 70.72% | NA |
| All Indica | 2759 | 1.50% | 0.10% | 14.10% | 84.34% | NA |
| All Japonica | 1512 | 50.10% | 4.10% | 1.12% | 44.71% | NA |
| Aus | 269 | 3.00% | 0.00% | 20.82% | 76.21% | NA |
| Indica I | 595 | 2.00% | 0.00% | 8.91% | 89.08% | NA |
| Indica II | 465 | 1.10% | 0.00% | 4.09% | 94.84% | NA |
| Indica III | 913 | 1.20% | 0.00% | 24.10% | 74.70% | NA |
| Indica Intermediate | 786 | 1.70% | 0.30% | 12.34% | 85.75% | NA |
| Temperate Japonica | 767 | 79.90% | 7.30% | 0.39% | 12.39% | NA |
| Tropical Japonica | 504 | 6.50% | 0.00% | 2.78% | 90.67% | NA |
| Japonica Intermediate | 241 | 46.10% | 2.50% | 0.00% | 51.45% | NA |
| VI/Aromatic | 96 | 10.40% | 0.00% | 13.54% | 76.04% | NA |
| Intermediate | 90 | 25.60% | 1.10% | 5.56% | 67.78% | NA |
Allele Effect:
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1000647302 | A -> G | LOC_Os10g02030.1 | missense_variant ; p.Leu428Pro; MODERATE | nonsynonymous_codon ; L428P | Average:6.858; most accessible tissue: Callus, score: 20.804 | benign  |
-0.78 |
TOLERATED | 1.00 |
| vg1000647302 | A -> DEL | LOC_Os10g02030.1 | N | frameshift_variant | Average:6.858; most accessible tissue: Callus, score: 20.804 | N | N | N | N |
Putative Genotype-Phenotype Associations:
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1000647302 | NA | 2.47E-08 | mr1757 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000647302 | NA | 7.85E-07 | mr1050_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000647302 | NA | 1.43E-06 | mr1272_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000647302 | 5.04E-09 | NA | mr1310_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000647302 | 8.63E-09 | NA | mr1310_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000647302 | NA | 1.71E-07 | mr1549_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000647302 | NA | 9.16E-06 | mr1757_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000647302 | 9.29E-06 | 9.29E-06 | mr1832_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000647302 | 7.21E-06 | 7.21E-06 | mr1843_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000647302 | NA | 6.07E-06 | mr1968_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |