| Variant ID: vg1000645768 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 645768 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.68, A: 0.32, others allele: 0.00, population size: 97. )
TTTACAACAATTACGGCAATAGATCGGCGGTGACGGTTGTCCGCACGTACTTTCTCCTCACTATTGTTCCTTCCTTGTGATCGCTACGTGAGTAAGGGGT[A/G]
TCTTCGTTTGATAGGAGGATGCTAGGGTCAACCGTCACCGTGAAAGGGGGTTGCCCATCAAACTGATCGTAATCCTCGTCAGTCTTGTCGTCTACTCCAA
TTGGAGTAGACGACAAGACTGACGAGGATTACGATCAGTTTGATGGGCAACCCCCTTTCACGGTGACGGTTGACCCTAGCATCCTCCTATCAAACGAAGA[T/C]
ACCCCTTACTCACGTAGCGATCACAAGGAAGGAACAATAGTGAGGAGAAAGTACGTGCGGACAACCGTCACCGCCGATCTATTGCCGTAATTGTTGTAAA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 18.90% | 2.20% | 25.41% | 53.51% | NA |
| All Indica | 2759 | 1.30% | 2.90% | 32.48% | 63.36% | NA |
| All Japonica | 1512 | 54.00% | 0.70% | 3.51% | 41.87% | NA |
| Aus | 269 | 3.70% | 3.70% | 56.88% | 35.69% | NA |
| Indica I | 595 | 1.50% | 2.40% | 36.97% | 59.16% | NA |
| Indica II | 465 | 1.30% | 0.90% | 13.98% | 83.87% | NA |
| Indica III | 913 | 0.90% | 4.40% | 39.65% | 55.09% | NA |
| Indica Intermediate | 786 | 1.70% | 2.70% | 31.68% | 63.99% | NA |
| Temperate Japonica | 767 | 87.40% | 0.00% | 0.52% | 12.13% | NA |
| Tropical Japonica | 504 | 6.20% | 2.00% | 4.76% | 87.10% | NA |
| Japonica Intermediate | 241 | 47.70% | 0.00% | 10.37% | 41.91% | NA |
| VI/Aromatic | 96 | 9.40% | 2.10% | 81.25% | 7.29% | NA |
| Intermediate | 90 | 25.60% | 1.10% | 23.33% | 50.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1000645768 | A -> G | LOC_Os10g02020.1 | downstream_gene_variant ; 1512.0bp to feature; MODIFIER | silent_mutation | Average:11.299; most accessible tissue: Minghui63 panicle, score: 16.27 | N | N | N | N |
| vg1000645768 | A -> G | LOC_Os10g02030.1 | downstream_gene_variant ; 79.0bp to feature; MODIFIER | silent_mutation | Average:11.299; most accessible tissue: Minghui63 panicle, score: 16.27 | N | N | N | N |
| vg1000645768 | A -> G | LOC_Os10g02020-LOC_Os10g02030 | intergenic_region ; MODIFIER | silent_mutation | Average:11.299; most accessible tissue: Minghui63 panicle, score: 16.27 | N | N | N | N |
| vg1000645768 | A -> DEL | N | N | silent_mutation | Average:11.299; most accessible tissue: Minghui63 panicle, score: 16.27 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1000645768 | NA | 4.16E-07 | mr1006 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000645768 | NA | 3.66E-07 | mr1052 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000645768 | NA | 6.00E-15 | mr1156 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000645768 | NA | 2.63E-06 | mr1156 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000645768 | NA | 3.94E-09 | mr1163 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000645768 | NA | 8.96E-08 | mr1192 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000645768 | NA | 9.92E-06 | mr1289 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000645768 | NA | 1.19E-06 | mr1295 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000645768 | 9.10E-12 | 4.42E-32 | mr1300 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000645768 | NA | 1.35E-08 | mr1300 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/