\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1000642191:

Variant ID: vg1000642191 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 642191
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.95, A: 0.05, others allele: 0.00, population size: 85. )

Flanking Sequence (100 bp) in Reference Genome:


CCATCTCTATCCGTGTCCTTTTGTTTAGGACTAGACTGAGCACCGATTTAAGCCTTACCCATTAGACATGTGGTTAGTACGGTAGTGCTTTGCAACAGAG[A/G]
CCCGAGCTTAATCCTTATATTGGCCGGGGTGCTACTTCCCATAACTGGCATGCACCCAAACCCCACCGGAAAACATGTTTTAGGGGTTTTGAAAGAGGAA

Reverse complement sequence

TTCCTCTTTCAAAACCCCTAAAACATGTTTTCCGGTGGGGTTTGGGTGCATGCCAGTTATGGGAAGTAGCACCCCGGCCAATATAAGGATTAAGCTCGGG[T/C]
CTCTGTTGCAAAGCACTACCGTACTAACCACATGTCTAATGGGTAAGGCTTAAATCGGTGCTCAGTCTAGTCCTAAACAAAAGGACACGGATAGAGATGG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 18.70% 1.80% 37.22% 42.30% NA
All Indica  2759 1.50% 0.70% 56.22% 41.54% NA
All Japonica  1512 49.90% 4.20% 1.85% 44.05% NA
Aus  269 15.60% 0.00% 40.15% 44.24% NA
Indica I  595 1.20% 0.30% 53.61% 44.87% NA
Indica II  465 1.30% 0.00% 47.96% 50.75% NA
Indica III  913 1.80% 1.40% 60.35% 36.47% NA
Indica Intermediate  786 1.70% 0.60% 58.27% 39.44% NA
Temperate Japonica  767 79.90% 7.30% 0.52% 12.26% NA
Tropical Japonica  504 6.30% 0.20% 2.58% 90.87% NA
Japonica Intermediate  241 45.60% 2.50% 4.56% 47.30% NA
VI/Aromatic  96 20.80% 0.00% 46.88% 32.29% NA
Intermediate  90 27.80% 1.10% 30.00% 41.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1000642191 A -> G LOC_Os10g02010.1 upstream_gene_variant ; 3162.0bp to feature; MODIFIER silent_mutation Average:13.476; most accessible tissue: Zhenshan97 flag leaf, score: 18.943 N N N N
vg1000642191 A -> G LOC_Os10g02020.1 upstream_gene_variant ; 1628.0bp to feature; MODIFIER silent_mutation Average:13.476; most accessible tissue: Zhenshan97 flag leaf, score: 18.943 N N N N
vg1000642191 A -> G LOC_Os10g02030.1 downstream_gene_variant ; 3656.0bp to feature; MODIFIER silent_mutation Average:13.476; most accessible tissue: Zhenshan97 flag leaf, score: 18.943 N N N N
vg1000642191 A -> G LOC_Os10g02010-LOC_Os10g02020 intergenic_region ; MODIFIER silent_mutation Average:13.476; most accessible tissue: Zhenshan97 flag leaf, score: 18.943 N N N N
vg1000642191 A -> DEL N N silent_mutation Average:13.476; most accessible tissue: Zhenshan97 flag leaf, score: 18.943 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1000642191 9.29E-11 1.10E-27 mr1300 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000642191 7.19E-06 1.72E-08 mr1300 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000642191 2.06E-10 7.12E-39 mr1310 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000642191 NA 7.03E-08 mr1310 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000642191 1.06E-07 2.56E-07 mr1498 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000642191 7.06E-08 NA mr1925 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000642191 1.20E-12 5.67E-45 mr1926 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000642191 NA 1.18E-09 mr1926 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000642191 2.92E-08 3.50E-13 mr1959 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000642191 4.60E-06 1.54E-07 mr1959 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000642191 3.16E-16 3.64E-42 mr1310_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000642191 1.75E-09 1.75E-14 mr1310_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000642191 7.76E-08 6.86E-17 mr1959_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000642191 NA 1.20E-08 mr1959_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251