\
| Variant ID: vg1000624564 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 624564 |
| Reference Allele: G | Alternative Allele: C,A |
| Primary Allele: C | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
TGCTAAGTTCAACAATAGTTTAATTATCTCGTTCGTACACGTTTCGCTCGCGTTCGTTCGCGTTCGTTCACGTTCGTTCGCGTTTCGTTCACGTTCGTTC[G/C,A]
TGTTCGTTCACGTTTCGTTCATGTTCGTTCACGTTTCGTTCGCGTTTCAATCACGTTCGTTTACGTCGTTCGCATTCGTTCACGTTTCGTTCGCGTTCGT
ACGAACGCGAACGAAACGTGAACGAATGCGAACGACGTAAACGAACGTGATTGAAACGCGAACGAAACGTGAACGAACATGAACGAAACGTGAACGAACA[C/G,T]
GAACGAACGTGAACGAAACGCGAACGAACGTGAACGAACGCGAACGAACGCGAGCGAAACGTGTACGAACGAGATAATTAAACTATTGTTGAACTTAGCA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 61.70% | 12.80% | 6.03% | 19.47% | A: 0.04% |
| All Indica | 2759 | 72.90% | 1.90% | 7.97% | 17.14% | A: 0.04% |
| All Japonica | 1512 | 44.10% | 24.30% | 3.64% | 27.91% | NA |
| Aus | 269 | 49.80% | 47.20% | 0.74% | 2.23% | NA |
| Indica I | 595 | 55.50% | 0.20% | 6.05% | 38.32% | NA |
| Indica II | 465 | 94.20% | 0.90% | 1.29% | 3.66% | NA |
| Indica III | 913 | 71.30% | 3.50% | 14.79% | 10.41% | NA |
| Indica Intermediate | 786 | 75.40% | 2.00% | 5.47% | 16.92% | A: 0.13% |
| Temperate Japonica | 767 | 13.00% | 33.60% | 6.13% | 47.20% | NA |
| Tropical Japonica | 504 | 89.30% | 6.20% | 1.19% | 3.37% | NA |
| Japonica Intermediate | 241 | 48.50% | 32.80% | 0.83% | 17.84% | NA |
| VI/Aromatic | 96 | 47.90% | 37.50% | 3.12% | 10.42% | A: 1.04% |
| Intermediate | 90 | 61.10% | 23.30% | 5.56% | 10.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1000624564 | G -> C | LOC_Os10g01984.1 | intron_variant ; MODIFIER | silent_mutation | Average:21.366; most accessible tissue: Minghui63 panicle, score: 42.799 | N | N | N | N |
| vg1000624564 | G -> A | LOC_Os10g01984.1 | intron_variant ; MODIFIER | silent_mutation | Average:21.366; most accessible tissue: Minghui63 panicle, score: 42.799 | N | N | N | N |
| vg1000624564 | G -> DEL | N | N | silent_mutation | Average:21.366; most accessible tissue: Minghui63 panicle, score: 42.799 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1000624564 | 2.49E-06 | NA | mr1002 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000624564 | 6.98E-17 | 4.53E-33 | mr1300 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000624564 | 4.97E-10 | 2.17E-14 | mr1300 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000624564 | 1.37E-18 | 4.15E-45 | mr1310 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000624564 | 4.49E-11 | 1.13E-17 | mr1310 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000624564 | NA | 2.83E-09 | mr1457 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000624564 | NA | 2.18E-06 | mr1548 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000624564 | NA | 4.10E-06 | mr1912 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000624564 | 7.87E-24 | 8.59E-59 | mr1926 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000624564 | 9.93E-12 | 5.17E-20 | mr1926 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000624564 | 8.26E-10 | 9.90E-14 | mr1959 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000624564 | 9.47E-09 | 6.50E-11 | mr1959 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000624564 | 7.57E-28 | 3.74E-50 | mr1310_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000624564 | 4.45E-17 | 1.13E-27 | mr1310_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000624564 | 2.08E-13 | 1.64E-22 | mr1959_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000624564 | 9.70E-10 | 2.79E-16 | mr1959_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |