Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1000604182:

Variant ID: vg1000604182 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 604182
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 100. )

Flanking Sequence (100 bp) in Reference Genome:

CAACTGACTGCACAACCTGTTGCTGAATTGGTTGTACGACCTGTTGGATTGGGGGTGTTTGTTGAATCGGCTGCTGCTGGACTAGATCAACAGTAGGTTG[A/G]
AGTGGTAGAAACATGGTAGCAACCTGATCCTGCGTTAGCCGATTCGCAACCTGCCCACTATGCTGTGGGTTCTCTCTCATCAACTGCCGAGGATTAACCA

Reverse complement sequence

TGGTTAATCCTCGGCAGTTGATGAGAGAGAACCCACAGCATAGTGGGCAGGTTGCGAATCGGCTAACGCAGGATCAGGTTGCTACCATGTTTCTACCACT[T/C]
CAACCTACTGTTGATCTAGTCCAGCAGCAGCCGATTCAACAAACACCCCCAATCCAACAGGTCGTACAACCAATTCAGCAACAGGTTGTGCAGTCAGTTG

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	59.70%	38.60%	0.25%	1.48%	NA
All Indica	2759	58.60%	41.20%	0.14%	0.07%	NA
All Japonica	1512	53.40%	43.10%	0.33%	3.24%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	62.50%	37.00%	0.50%	0.00%	NA
Indica II	465	56.60%	43.40%	0.00%	0.00%	NA
Indica III	913	52.70%	47.00%	0.11%	0.22%	NA
Indica Intermediate	786	63.60%	36.40%	0.00%	0.00%	NA
Temperate Japonica	767	81.60%	12.50%	0.26%	5.61%	NA
Tropical Japonica	504	8.50%	91.30%	0.20%	0.00%	NA
Japonica Intermediate	241	57.30%	39.40%	0.83%	2.49%	NA
VI/Aromatic	96	80.20%	0.00%	2.08%	17.71%	NA
Intermediate	90	57.80%	38.90%	1.11%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1000604182	A -> G	LOC_Os10g01960.1	synonymous_variant ; p.Leu240Leu; LOW	synonymous_codon	Average:56.716; most accessible tissue: Zhenshan97 flag leaf, score: 77.473	N	N	N	N
vg1000604182	A -> DEL	LOC_Os10g01960.1	N	frameshift_variant	Average:56.716; most accessible tissue: Zhenshan97 flag leaf, score: 77.473	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1000604182	NA	1.14E-07	mr1156	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000604182	NA	3.80E-06	mr1179	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000604182	NA	3.67E-07	mr1192	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000604182	NA	1.41E-06	mr1229	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000604182	NA	9.28E-11	mr1251	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000604182	NA	1.01E-06	mr1252	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000604182	NA	1.16E-08	mr1300	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000604182	NA	3.84E-11	mr1310	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000604182	NA	3.46E-11	mr1486	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000604182	NA	5.83E-06	mr1495	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000604182	NA	3.48E-10	mr1539	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000604182	NA	1.22E-12	mr1540	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000604182	NA	9.48E-08	mr1548	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000604182	NA	1.84E-10	mr1549	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000604182	NA	1.61E-06	mr1570	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000604182	NA	8.32E-11	mr1580	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000604182	NA	3.83E-08	mr1624	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000604182	NA	1.18E-08	mr1679	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000604182	NA	4.86E-07	mr1715	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000604182	NA	8.89E-13	mr1732	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000604182	NA	1.59E-07	mr1733	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000604182	8.83E-08	1.01E-10	mr1736	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000604182	NA	1.59E-08	mr1757	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000604182	NA	9.84E-11	mr1825	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000604182	NA	5.23E-07	mr1870	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000604182	NA	8.45E-07	mr1912	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000604182	NA	2.15E-11	mr1926	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000604182	NA	3.82E-06	mr1959	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000604182	3.32E-06	3.54E-13	mr1310_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000604182	NA	3.46E-09	mr1486_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000604182	NA	4.22E-09	mr1959_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251