Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1000599056:

Variant ID: vg1000599056 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 599056
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AATATAAACTTATACCCTTTACTTGACGGTGGATTAATCATGCTGATCATATCAATTCCCCAACCTCTAAACGGCCATGATTTAATAATAGGATTCGTAG[T/C]
CGATGCCGGCGCTCTCTGGATCGCTCCAAATTTCTGACAATCTTGACAACCTTTATAATATCTGAAACAATCCTCCAGCATCGTCGGCCAAAAGTATCCA

Reverse complement sequence

TGGATACTTTTGGCCGACGATGCTGGAGGATTGTTTCAGATATTATAAAGGTTGTCAAGATTGTCAGAAATTTGGAGCGATCCAGAGAGCGCCGGCATCG[A/G]
CTACGAATCCTATTATTAAATCATGGCCGTTTAGAGGTTGGGGAATTGATATGATCAGCATGATTAATCCACCGTCAAGTAAAGGGTATAAGTTTATATT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	79.90%	16.80%	1.61%	1.61%	NA
All Indica	2759	98.10%	0.70%	1.12%	0.07%	NA
All Japonica	1512	46.20%	49.30%	0.26%	4.23%	NA
Aus	269	94.40%	2.60%	2.97%	0.00%	NA
Indica I	595	99.30%	0.70%	0.00%	0.00%	NA
Indica II	465	98.90%	1.10%	0.00%	0.00%	NA
Indica III	913	96.60%	0.20%	2.96%	0.22%	NA
Indica Intermediate	786	98.50%	1.00%	0.51%	0.00%	NA
Temperate Japonica	767	13.40%	79.00%	0.13%	7.43%	NA
Tropical Japonica	504	94.00%	6.00%	0.00%	0.00%	NA
Japonica Intermediate	241	50.20%	45.60%	1.24%	2.90%	NA
VI/Aromatic	96	55.20%	7.30%	28.12%	9.38%	NA
Intermediate	90	73.30%	18.90%	6.67%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1000599056	T -> C	LOC_Os10g01940.1	downstream_gene_variant ; 1654.0bp to feature; MODIFIER	silent_mutation	Average:29.605; most accessible tissue: Minghui63 young leaf, score: 48.378	N	N	N	N
vg1000599056	T -> C	LOC_Os10g01960.1	downstream_gene_variant ; 3182.0bp to feature; MODIFIER	silent_mutation	Average:29.605; most accessible tissue: Minghui63 young leaf, score: 48.378	N	N	N	N
vg1000599056	T -> C	LOC_Os10g01950.1	intron_variant ; MODIFIER	silent_mutation	Average:29.605; most accessible tissue: Minghui63 young leaf, score: 48.378	N	N	N	N
vg1000599056	T -> DEL	N	N	silent_mutation	Average:29.605; most accessible tissue: Minghui63 young leaf, score: 48.378	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1000599056	NA	2.77E-06	mr1192	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000599056	2.72E-20	3.89E-42	mr1300	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000599056	4.24E-09	1.23E-13	mr1300	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000599056	4.56E-20	1.73E-59	mr1310	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000599056	5.63E-09	8.17E-16	mr1310	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000599056	NA	1.93E-06	mr1548	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000599056	NA	5.29E-07	mr1570	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000599056	NA	2.55E-08	mr1624	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000599056	NA	9.79E-08	mr1825	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000599056	1.40E-07	7.74E-06	mr1854	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000599056	6.17E-27	4.75E-73	mr1926	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000599056	9.54E-10	4.81E-18	mr1926	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000599056	2.05E-11	3.94E-18	mr1959	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000599056	3.84E-07	2.51E-09	mr1959	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000599056	NA	2.18E-06	mr1977	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000599056	2.74E-29	1.24E-66	mr1310_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000599056	4.03E-13	5.49E-24	mr1310_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000599056	1.17E-14	3.34E-27	mr1959_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000599056	2.70E-08	1.12E-14	mr1959_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251