\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1000576410:

Variant ID: vg1000576410 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 576410
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCTTTAATATATTTTATGTGTTGGATAATTAAAAACCGACATCTATAATATGCTAAATGTGTCGGTTTTTTTAAAAATTGGCATCTATAAACGAGCCGAG[T/C]
CAAATTGAGACATAGAGGGCCCCACATGCCCCCACCCTTATCCCCTCACCCACCGCGCGCCCCTCCACCACATACTCCTCTCTCTCTCTCTCTCTCTCTC

Reverse complement sequence

GAGAGAGAGAGAGAGAGAGAGAGGAGTATGTGGTGGAGGGGCGCGCGGTGGGTGAGGGGATAAGGGTGGGGGCATGTGGGGCCCTCTATGTCTCAATTTG[A/G]
CTCGGCTCGTTTATAGATGCCAATTTTTAAAAAAACCGACACATTTAGCATATTATAGATGTCGGTTTTTAATTATCCAACACATAAAATATATTAAAGG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 76.40% 16.80% 0.04% 6.73% NA
All Indica  2759 96.00% 0.60% 0.04% 3.41% NA
All Japonica  1512 50.30% 49.20% 0.07% 0.46% NA
Aus  269 34.90% 3.30% 0.00% 61.71% NA
Indica I  595 99.30% 0.70% 0.00% 0.00% NA
Indica II  465 98.90% 0.40% 0.00% 0.65% NA
Indica III  913 94.00% 0.30% 0.00% 5.70% NA
Indica Intermediate  786 94.00% 0.90% 0.13% 4.96% NA
Temperate Japonica  767 21.50% 78.40% 0.13% 0.00% NA
Tropical Japonica  504 93.30% 6.70% 0.00% 0.00% NA
Japonica Intermediate  241 51.90% 45.20% 0.00% 2.90% NA
VI/Aromatic  96 46.90% 9.40% 0.00% 43.75% NA
Intermediate  90 72.20% 17.80% 0.00% 10.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1000576410 T -> C LOC_Os10g01890.1 upstream_gene_variant ; 2391.0bp to feature; MODIFIER silent_mutation Average:54.052; most accessible tissue: Zhenshan97 young leaf, score: 80.848 N N N N
vg1000576410 T -> C LOC_Os10g01900.1 upstream_gene_variant ; 638.0bp to feature; MODIFIER silent_mutation Average:54.052; most accessible tissue: Zhenshan97 young leaf, score: 80.848 N N N N
vg1000576410 T -> C LOC_Os10g01910.1 intron_variant ; MODIFIER silent_mutation Average:54.052; most accessible tissue: Zhenshan97 young leaf, score: 80.848 N N N N
vg1000576410 T -> DEL N N silent_mutation Average:54.052; most accessible tissue: Zhenshan97 young leaf, score: 80.848 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1000576410 4.55E-06 4.55E-06 mr1260 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000576410 2.56E-27 3.29E-49 mr1300 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000576410 3.77E-12 4.97E-17 mr1300 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000576410 2.77E-32 7.82E-73 mr1310 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000576410 7.91E-14 5.26E-21 mr1310 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000576410 4.29E-07 NA mr1498 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000576410 2.63E-42 5.66E-89 mr1926 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000576410 1.23E-15 8.37E-25 mr1926 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000576410 4.75E-15 5.92E-21 mr1959 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000576410 1.70E-09 8.56E-12 mr1959 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000576410 4.08E-50 5.64E-85 mr1310_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000576410 9.92E-24 1.42E-35 mr1310_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000576410 4.48E-23 7.05E-34 mr1959_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000576410 6.25E-13 5.03E-20 mr1959_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251