| Variant ID: vg1000576410 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 576410 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
CCTTTAATATATTTTATGTGTTGGATAATTAAAAACCGACATCTATAATATGCTAAATGTGTCGGTTTTTTTAAAAATTGGCATCTATAAACGAGCCGAG[T/C]
CAAATTGAGACATAGAGGGCCCCACATGCCCCCACCCTTATCCCCTCACCCACCGCGCGCCCCTCCACCACATACTCCTCTCTCTCTCTCTCTCTCTCTC
GAGAGAGAGAGAGAGAGAGAGAGGAGTATGTGGTGGAGGGGCGCGCGGTGGGTGAGGGGATAAGGGTGGGGGCATGTGGGGCCCTCTATGTCTCAATTTG[A/G]
CTCGGCTCGTTTATAGATGCCAATTTTTAAAAAAACCGACACATTTAGCATATTATAGATGTCGGTTTTTAATTATCCAACACATAAAATATATTAAAGG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 76.40% | 16.80% | 0.04% | 6.73% | NA |
| All Indica | 2759 | 96.00% | 0.60% | 0.04% | 3.41% | NA |
| All Japonica | 1512 | 50.30% | 49.20% | 0.07% | 0.46% | NA |
| Aus | 269 | 34.90% | 3.30% | 0.00% | 61.71% | NA |
| Indica I | 595 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.90% | 0.40% | 0.00% | 0.65% | NA |
| Indica III | 913 | 94.00% | 0.30% | 0.00% | 5.70% | NA |
| Indica Intermediate | 786 | 94.00% | 0.90% | 0.13% | 4.96% | NA |
| Temperate Japonica | 767 | 21.50% | 78.40% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 93.30% | 6.70% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 51.90% | 45.20% | 0.00% | 2.90% | NA |
| VI/Aromatic | 96 | 46.90% | 9.40% | 0.00% | 43.75% | NA |
| Intermediate | 90 | 72.20% | 17.80% | 0.00% | 10.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1000576410 | T -> C | LOC_Os10g01890.1 | upstream_gene_variant ; 2391.0bp to feature; MODIFIER | silent_mutation | Average:54.052; most accessible tissue: Zhenshan97 young leaf, score: 80.848 | N | N | N | N |
| vg1000576410 | T -> C | LOC_Os10g01900.1 | upstream_gene_variant ; 638.0bp to feature; MODIFIER | silent_mutation | Average:54.052; most accessible tissue: Zhenshan97 young leaf, score: 80.848 | N | N | N | N |
| vg1000576410 | T -> C | LOC_Os10g01910.1 | intron_variant ; MODIFIER | silent_mutation | Average:54.052; most accessible tissue: Zhenshan97 young leaf, score: 80.848 | N | N | N | N |
| vg1000576410 | T -> DEL | N | N | silent_mutation | Average:54.052; most accessible tissue: Zhenshan97 young leaf, score: 80.848 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1000576410 | 4.55E-06 | 4.55E-06 | mr1260 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000576410 | 2.56E-27 | 3.29E-49 | mr1300 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000576410 | 3.77E-12 | 4.97E-17 | mr1300 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000576410 | 2.77E-32 | 7.82E-73 | mr1310 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000576410 | 7.91E-14 | 5.26E-21 | mr1310 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000576410 | 4.29E-07 | NA | mr1498 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000576410 | 2.63E-42 | 5.66E-89 | mr1926 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000576410 | 1.23E-15 | 8.37E-25 | mr1926 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000576410 | 4.75E-15 | 5.92E-21 | mr1959 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000576410 | 1.70E-09 | 8.56E-12 | mr1959 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/