Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1000576410:

Variant ID: vg1000576410 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 576410
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CCTTTAATATATTTTATGTGTTGGATAATTAAAAACCGACATCTATAATATGCTAAATGTGTCGGTTTTTTTAAAAATTGGCATCTATAAACGAGCCGAG[T/C]
CAAATTGAGACATAGAGGGCCCCACATGCCCCCACCCTTATCCCCTCACCCACCGCGCGCCCCTCCACCACATACTCCTCTCTCTCTCTCTCTCTCTCTC

Reverse complement sequence

GAGAGAGAGAGAGAGAGAGAGAGGAGTATGTGGTGGAGGGGCGCGCGGTGGGTGAGGGGATAAGGGTGGGGGCATGTGGGGCCCTCTATGTCTCAATTTG[A/G]
CTCGGCTCGTTTATAGATGCCAATTTTTAAAAAAACCGACACATTTAGCATATTATAGATGTCGGTTTTTAATTATCCAACACATAAAATATATTAAAGG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	76.40%	16.80%	0.04%	6.73%	NA
All Indica	2759	96.00%	0.60%	0.04%	3.41%	NA
All Japonica	1512	50.30%	49.20%	0.07%	0.46%	NA
Aus	269	34.90%	3.30%	0.00%	61.71%	NA
Indica I	595	99.30%	0.70%	0.00%	0.00%	NA
Indica II	465	98.90%	0.40%	0.00%	0.65%	NA
Indica III	913	94.00%	0.30%	0.00%	5.70%	NA
Indica Intermediate	786	94.00%	0.90%	0.13%	4.96%	NA
Temperate Japonica	767	21.50%	78.40%	0.13%	0.00%	NA
Tropical Japonica	504	93.30%	6.70%	0.00%	0.00%	NA
Japonica Intermediate	241	51.90%	45.20%	0.00%	2.90%	NA
VI/Aromatic	96	46.90%	9.40%	0.00%	43.75%	NA
Intermediate	90	72.20%	17.80%	0.00%	10.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1000576410	T -> C	LOC_Os10g01890.1	upstream_gene_variant ; 2391.0bp to feature; MODIFIER	silent_mutation	Average:54.052; most accessible tissue: Zhenshan97 young leaf, score: 80.848	N	N	N	N
vg1000576410	T -> C	LOC_Os10g01900.1	upstream_gene_variant ; 638.0bp to feature; MODIFIER	silent_mutation	Average:54.052; most accessible tissue: Zhenshan97 young leaf, score: 80.848	N	N	N	N
vg1000576410	T -> C	LOC_Os10g01910.1	intron_variant ; MODIFIER	silent_mutation	Average:54.052; most accessible tissue: Zhenshan97 young leaf, score: 80.848	N	N	N	N
vg1000576410	T -> DEL	N	N	silent_mutation	Average:54.052; most accessible tissue: Zhenshan97 young leaf, score: 80.848	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1000576410	4.55E-06	4.55E-06	mr1260	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000576410	2.56E-27	3.29E-49	mr1300	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000576410	3.77E-12	4.97E-17	mr1300	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000576410	2.77E-32	7.82E-73	mr1310	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000576410	7.91E-14	5.26E-21	mr1310	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000576410	4.29E-07	NA	mr1498	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000576410	2.63E-42	5.66E-89	mr1926	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000576410	1.23E-15	8.37E-25	mr1926	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000576410	4.75E-15	5.92E-21	mr1959	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000576410	1.70E-09	8.56E-12	mr1959	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000576410	4.08E-50	5.64E-85	mr1310_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000576410	9.92E-24	1.42E-35	mr1310_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000576410	4.48E-23	7.05E-34	mr1959_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000576410	6.25E-13	5.03E-20	mr1959_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251