Variant ID: vg1000572925 (JBrowse) | Variation Type: SNP |
Chromosome: chr10 | Position: 572925 |
Reference Allele: C | Alternative Allele: T |
Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
CGGGTGGGAACTTGAACTGGGGTGGGATTGGACGATTCTTGATTCCCCCACTCAGTGGTAGCCCCTTTTCGTCCCCTACCCTGTTCACGGCACCTTGCTG[C/T]
GGGTATGGCGTGGCGAAGGGTGAAGTCATGGCTTGCGCATGAGGTTGTATCATGATGTTCGGCTGCCCAGCTCCGATTGGTGATGCTTGGTGAGGCGCCA
TGGCGCCTCACCAAGCATCACCAATCGGAGCTGGGCAGCCGAACATCATGATACAACCTCATGCGCAAGCCATGACTTCACCCTTCGCCACGCCATACCC[G/A]
CAGCAAGGTGCCGTGAACAGGGTAGGGGACGAAAAGGGGCTACCACTGAGTGGGGGAATCAAGAATCGTCCAATCCCACCCCAGTTCAAGTTCCCACCCG
Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 92.00% | 1.80% | 1.35% | 4.82% | NA |
All Indica | 2759 | 96.60% | 0.40% | 1.12% | 1.85% | NA |
All Japonica | 1512 | 94.90% | 4.70% | 0.00% | 0.40% | NA |
Aus | 269 | 41.30% | 1.10% | 10.78% | 46.84% | NA |
Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica II | 465 | 99.40% | 0.00% | 0.22% | 0.43% | NA |
Indica III | 913 | 94.20% | 0.70% | 1.97% | 3.18% | NA |
Indica Intermediate | 786 | 95.30% | 0.60% | 1.53% | 2.54% | NA |
Temperate Japonica | 767 | 91.50% | 8.50% | 0.00% | 0.00% | NA |
Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Japonica Intermediate | 241 | 95.00% | 2.50% | 0.00% | 2.49% | NA |
VI/Aromatic | 96 | 58.30% | 0.00% | 2.08% | 39.58% | NA |
Intermediate | 90 | 88.90% | 1.10% | 2.22% | 7.78% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg1000572925 | C -> T | LOC_Os10g01890.1 | synonymous_variant ; p.Pro365Pro; LOW | synonymous_codon | Average:61.107; most accessible tissue: Minghui63 flag leaf, score: 82.289 | N | N | N | N |
vg1000572925 | C -> DEL | LOC_Os10g01890.1 | N | frameshift_variant | Average:61.107; most accessible tissue: Minghui63 flag leaf, score: 82.289 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg1000572925 | NA | 8.59E-10 | mr1757 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1000572925 | 3.69E-10 | NA | mr1310_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1000572925 | 1.15E-09 | NA | mr1310_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1000572925 | NA | 2.12E-06 | mr1354_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1000572925 | NA | 2.19E-08 | mr1549_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1000572925 | NA | 3.79E-07 | mr1757_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1000572925 | 8.66E-06 | NA | mr1959_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |