Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1000569106:

Variant ID: vg1000569106 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 569106
Reference Allele: G	Alternative Allele: T
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 55. )

Flanking Sequence (100 bp) in Reference Genome:

CCAGGGCGAAGGGGAGGACGCGGCGGCCGGAGTGGGTCGAGGCGATGCCCAAGATCACCCAGAGGTGTGAGGCCCTCCGCCCTCTCCTTAGATTTTTGTA[G/T]
CTTTTCTTGTGTTTGCCACGGAAGGCGAACAATGTACATTTGGCCGATGGCCCTTTTCCCTCCTTACTGTAGCCGAAAACGGCCTTTTGGATATATGGAA

Reverse complement sequence

TTCCATATATCCAAAAGGCCGTTTTCGGCTACAGTAAGGAGGGAAAAGGGCCATCGGCCAAATGTACATTGTTCGCCTTCCGTGGCAAACACAAGAAAAG[C/A]
TACAAAAATCTAAGGAGAGGGCGGAGGGCCTCACACCTCTGGGTGATCTTGGGCATCGCCTCGACCCACTCCGGCCGCCGCGTCCTCCCCTTCGCCCTGG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	18.80%	13.80%	4.34%	63.08%	NA
All Indica	2759	1.10%	23.20%	6.56%	69.19%	NA
All Japonica	1512	54.10%	0.30%	1.12%	44.51%	NA
Aus	269	4.10%	0.40%	0.74%	94.80%	NA
Indica I	595	1.30%	9.60%	2.69%	86.39%	NA
Indica II	465	1.10%	32.50%	5.59%	60.86%	NA
Indica III	913	0.20%	27.10%	10.19%	62.54%	NA
Indica Intermediate	786	1.90%	23.40%	5.85%	68.83%	NA
Temperate Japonica	767	87.10%	0.00%	0.13%	12.78%	NA
Tropical Japonica	504	6.90%	0.60%	2.58%	89.88%	NA
Japonica Intermediate	241	47.70%	0.40%	1.24%	50.62%	NA
VI/Aromatic	96	9.40%	0.00%	0.00%	90.62%	NA
Intermediate	90	24.40%	6.70%	5.56%	63.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1000569106	G -> T	LOC_Os10g01870.1	downstream_gene_variant ; 4382.0bp to feature; MODIFIER	silent_mutation	Average:19.76; most accessible tissue: Callus, score: 49.222	N	N	N	N
vg1000569106	G -> T	LOC_Os10g01890.1	downstream_gene_variant ; 1506.0bp to feature; MODIFIER	silent_mutation	Average:19.76; most accessible tissue: Callus, score: 49.222	N	N	N	N
vg1000569106	G -> T	LOC_Os10g01880.1	intron_variant ; MODIFIER	silent_mutation	Average:19.76; most accessible tissue: Callus, score: 49.222	N	N	N	N
vg1000569106	G -> DEL	N	N	silent_mutation	Average:19.76; most accessible tissue: Callus, score: 49.222	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1000569106	1.62E-06	1.62E-06	mr1011	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000569106	NA	5.25E-15	mr1156	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000569106	NA	5.35E-08	mr1156	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000569106	NA	2.80E-08	mr1163	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000569106	NA	4.68E-07	mr1179	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000569106	NA	4.93E-07	mr1192	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000569106	1.24E-09	9.22E-28	mr1300	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000569106	4.42E-06	4.38E-10	mr1300	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000569106	5.92E-10	2.94E-41	mr1310	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000569106	NA	1.49E-11	mr1310	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000569106	NA	3.08E-12	mr1486	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000569106	NA	5.01E-11	mr1539	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000569106	NA	2.08E-08	mr1548	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000569106	NA	5.15E-10	mr1549	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000569106	NA	3.23E-09	mr1563	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000569106	NA	1.82E-07	mr1570	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000569106	NA	1.79E-10	mr1580	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000569106	NA	1.89E-06	mr1588	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000569106	NA	2.49E-10	mr1624	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000569106	NA	1.28E-08	mr1624	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000569106	NA	8.89E-07	mr1736	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000569106	NA	5.39E-09	mr1757	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000569106	NA	3.21E-06	mr1780	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000569106	NA	3.28E-10	mr1825	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000569106	NA	2.27E-07	mr1870	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000569106	NA	3.96E-06	mr1912	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000569106	1.59E-11	4.31E-47	mr1926	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000569106	NA	3.38E-12	mr1926	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000569106	NA	2.37E-11	mr1959	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000569106	NA	1.12E-06	mr1959	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000569106	3.78E-06	9.42E-07	mr1047_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000569106	NA	5.67E-18	mr1156_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000569106	NA	1.48E-07	mr1156_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000569106	6.56E-09	8.34E-35	mr1310_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000569106	2.28E-06	3.70E-14	mr1310_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000569106	NA	1.58E-11	mr1486_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000569106	NA	4.85E-08	mr1563_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000569106	NA	3.59E-09	mr1624_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000569106	6.77E-06	9.60E-06	mr1834_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000569106	9.84E-07	4.35E-17	mr1959_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000569106	NA	1.63E-09	mr1959_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251