\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1000566988:

Variant ID: vg1000566988 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 566988
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 70. )

Flanking Sequence (100 bp) in Reference Genome:


CGACACCGAAAGGATGAGGACGGGGCAGCGAGAGGAGAGATCCATACCACCACGCGACGAGGCGAGGGAACGACAACGACGAACGGGCGCGGCGTAGACG[A/G]
ACGGCGAGGGAACGACTTCGGCGGCGATCCTTGGACGAAGGCGAGACACGGCCGGCACAAGGCTTGATGACGCGGAGCCGAGGACGAAGACGACAACGGG

Reverse complement sequence

CCCGTTGTCGTCTTCGTCCTCGGCTCCGCGTCATCAAGCCTTGTGCCGGCCGTGTCTCGCCTTCGTCCAAGGATCGCCGCCGAAGTCGTTCCCTCGCCGT[T/C]
CGTCTACGCCGCGCCCGTTCGTCGTTGTCGTTCCCTCGCCTCGTCGCGTGGTGGTATGGATCTCTCCTCTCGCTGCCCCGTCCTCATCCTTTCGGTGTCG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 78.00% 2.20% 9.65% 10.18% NA
All Indica  2759 82.90% 3.40% 9.03% 4.64% NA
All Japonica  1512 65.60% 0.30% 11.31% 22.82% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 79.70% 0.80% 7.73% 11.76% NA
Indica II  465 69.90% 5.60% 20.00% 4.52% NA
Indica III  913 90.30% 4.80% 4.49% 0.44% NA
Indica Intermediate  786 84.50% 2.50% 8.78% 4.20% NA
Temperate Japonica  767 90.00% 0.00% 1.69% 8.34% NA
Tropical Japonica  504 29.20% 0.80% 27.38% 42.66% NA
Japonica Intermediate  241 64.30% 0.00% 8.30% 27.39% NA
VI/Aromatic  96 67.70% 2.10% 30.21% 0.00% NA
Intermediate  90 80.00% 3.30% 7.78% 8.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1000566988 A -> G LOC_Os10g01880.1 upstream_gene_variant ; 423.0bp to feature; MODIFIER silent_mutation Average:22.729; most accessible tissue: Zhenshan97 flag leaf, score: 38.066 N N N N
vg1000566988 A -> G LOC_Os10g01870.1 downstream_gene_variant ; 2264.0bp to feature; MODIFIER silent_mutation Average:22.729; most accessible tissue: Zhenshan97 flag leaf, score: 38.066 N N N N
vg1000566988 A -> G LOC_Os10g01890.1 downstream_gene_variant ; 3624.0bp to feature; MODIFIER silent_mutation Average:22.729; most accessible tissue: Zhenshan97 flag leaf, score: 38.066 N N N N
vg1000566988 A -> G LOC_Os10g01870-LOC_Os10g01880 intergenic_region ; MODIFIER silent_mutation Average:22.729; most accessible tissue: Zhenshan97 flag leaf, score: 38.066 N N N N
vg1000566988 A -> DEL N N silent_mutation Average:22.729; most accessible tissue: Zhenshan97 flag leaf, score: 38.066 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1000566988 4.59E-07 8.15E-09 mr1341_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000566988 2.76E-07 2.76E-07 mr1341_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000566988 6.90E-06 NA mr1653_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251