\
| Variant ID: vg1000566988 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 566988 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 70. )
CGACACCGAAAGGATGAGGACGGGGCAGCGAGAGGAGAGATCCATACCACCACGCGACGAGGCGAGGGAACGACAACGACGAACGGGCGCGGCGTAGACG[A/G]
ACGGCGAGGGAACGACTTCGGCGGCGATCCTTGGACGAAGGCGAGACACGGCCGGCACAAGGCTTGATGACGCGGAGCCGAGGACGAAGACGACAACGGG
CCCGTTGTCGTCTTCGTCCTCGGCTCCGCGTCATCAAGCCTTGTGCCGGCCGTGTCTCGCCTTCGTCCAAGGATCGCCGCCGAAGTCGTTCCCTCGCCGT[T/C]
CGTCTACGCCGCGCCCGTTCGTCGTTGTCGTTCCCTCGCCTCGTCGCGTGGTGGTATGGATCTCTCCTCTCGCTGCCCCGTCCTCATCCTTTCGGTGTCG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 78.00% | 2.20% | 9.65% | 10.18% | NA |
| All Indica | 2759 | 82.90% | 3.40% | 9.03% | 4.64% | NA |
| All Japonica | 1512 | 65.60% | 0.30% | 11.31% | 22.82% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 79.70% | 0.80% | 7.73% | 11.76% | NA |
| Indica II | 465 | 69.90% | 5.60% | 20.00% | 4.52% | NA |
| Indica III | 913 | 90.30% | 4.80% | 4.49% | 0.44% | NA |
| Indica Intermediate | 786 | 84.50% | 2.50% | 8.78% | 4.20% | NA |
| Temperate Japonica | 767 | 90.00% | 0.00% | 1.69% | 8.34% | NA |
| Tropical Japonica | 504 | 29.20% | 0.80% | 27.38% | 42.66% | NA |
| Japonica Intermediate | 241 | 64.30% | 0.00% | 8.30% | 27.39% | NA |
| VI/Aromatic | 96 | 67.70% | 2.10% | 30.21% | 0.00% | NA |
| Intermediate | 90 | 80.00% | 3.30% | 7.78% | 8.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1000566988 | A -> G | LOC_Os10g01880.1 | upstream_gene_variant ; 423.0bp to feature; MODIFIER | silent_mutation | Average:22.729; most accessible tissue: Zhenshan97 flag leaf, score: 38.066 | N | N | N | N |
| vg1000566988 | A -> G | LOC_Os10g01870.1 | downstream_gene_variant ; 2264.0bp to feature; MODIFIER | silent_mutation | Average:22.729; most accessible tissue: Zhenshan97 flag leaf, score: 38.066 | N | N | N | N |
| vg1000566988 | A -> G | LOC_Os10g01890.1 | downstream_gene_variant ; 3624.0bp to feature; MODIFIER | silent_mutation | Average:22.729; most accessible tissue: Zhenshan97 flag leaf, score: 38.066 | N | N | N | N |
| vg1000566988 | A -> G | LOC_Os10g01870-LOC_Os10g01880 | intergenic_region ; MODIFIER | silent_mutation | Average:22.729; most accessible tissue: Zhenshan97 flag leaf, score: 38.066 | N | N | N | N |
| vg1000566988 | A -> DEL | N | N | silent_mutation | Average:22.729; most accessible tissue: Zhenshan97 flag leaf, score: 38.066 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1000566988 | 4.59E-07 | 8.15E-09 | mr1341_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000566988 | 2.76E-07 | 2.76E-07 | mr1341_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000566988 | 6.90E-06 | NA | mr1653_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |