\
| Variant ID: vg1000551614 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 551614 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.72, G: 0.28, others allele: 0.00, population size: 43. )
GGCTAGGTGCCGATGACATATCATTTATCTATAGGCCGATGTCATATGTACATTGATCGGCAAGTGTTAATAAGCAAATCAAAACTAAATCTACCCGATC[A/G]
GCTGTAGATATTAATGATATATAATCCTTATATCGATATATACTTAAATCAAGTGATTGGGATAGATCGGTCATCTTGCCGAGACAGTATAAATCACTTA
TAAGTGATTTATACTGTCTCGGCAAGATGACCGATCTATCCCAATCACTTGATTTAAGTATATATCGATATAAGGATTATATATCATTAATATCTACAGC[T/C]
GATCGGGTAGATTTAGTTTTGATTTGCTTATTAACACTTGCCGATCAATGTACATATGACATCGGCCTATAGATAAATGATATGTCATCGGCACCTAGCC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 17.40% | 1.70% | 16.63% | 64.30% | NA |
| All Indica | 2759 | 1.20% | 0.10% | 27.76% | 70.90% | NA |
| All Japonica | 1512 | 49.70% | 4.80% | 0.60% | 44.97% | NA |
| Aus | 269 | 3.70% | 0.40% | 0.37% | 95.54% | NA |
| Indica I | 595 | 1.50% | 0.00% | 22.86% | 75.63% | NA |
| Indica II | 465 | 1.70% | 0.00% | 18.28% | 80.00% | NA |
| Indica III | 913 | 0.30% | 0.00% | 41.18% | 58.49% | NA |
| Indica Intermediate | 786 | 1.80% | 0.40% | 21.50% | 76.34% | NA |
| Temperate Japonica | 767 | 78.60% | 8.60% | 0.13% | 12.65% | NA |
| Tropical Japonica | 504 | 7.30% | 0.00% | 1.59% | 91.07% | NA |
| Japonica Intermediate | 241 | 46.10% | 2.50% | 0.00% | 51.45% | NA |
| VI/Aromatic | 96 | 9.40% | 0.00% | 0.00% | 90.62% | NA |
| Intermediate | 90 | 20.00% | 3.30% | 11.11% | 65.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1000551614 | A -> G | LOC_Os10g01844.1 | upstream_gene_variant ; 2821.0bp to feature; MODIFIER | silent_mutation | Average:13.483; most accessible tissue: Callus, score: 25.831 | N | N | N | N |
| vg1000551614 | A -> G | LOC_Os10g01850.1 | intron_variant ; MODIFIER | silent_mutation | Average:13.483; most accessible tissue: Callus, score: 25.831 | N | N | N | N |
| vg1000551614 | A -> DEL | N | N | silent_mutation | Average:13.483; most accessible tissue: Callus, score: 25.831 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1000551614 | 1.12E-06 | NA | mr1757 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000551614 | NA | 8.59E-10 | mr1757 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000551614 | 1.89E-10 | NA | mr1310_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000551614 | 1.15E-09 | NA | mr1310_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000551614 | NA | 2.12E-06 | mr1354_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000551614 | NA | 2.19E-08 | mr1549_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000551614 | NA | 3.79E-07 | mr1757_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000551614 | 4.74E-07 | NA | mr1959_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |