| Variant ID: vg1000539208 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 539208 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.58, T: 0.40, others allele: 0.00, population size: 45. )
TGAACGGCCTCATTCGATTTCATATGAATTAATTATGAATTTTACAAGATTAATTAGAATTAAAGCCTATTAAAGAAAAGATTATTCCAAATTAATTAAA[T/C]
CATTTACAAATGATTTATAACTGAGACAAAAGATTAAAACAACCTCCGGAAAAGATTAGATCATATTTGGTAGATGACATATATTAAAAAGAAATAATGT
ACATTATTTCTTTTTAATATATGTCATCTACCAAATATGATCTAATCTTTTCCGGAGGTTGTTTTAATCTTTTGTCTCAGTTATAAATCATTTGTAAATG[A/G]
TTTAATTAATTTGGAATAATCTTTTCTTTAATAGGCTTTAATTCTAATTAATCTTGTAAAATTCATAATTAATTCATATGAAATCGAATGAGGCCGTTCA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 17.20% | 4.30% | 5.59% | 72.89% | NA |
| All Indica | 2759 | 1.00% | 3.30% | 6.09% | 89.60% | NA |
| All Japonica | 1512 | 49.50% | 5.40% | 2.38% | 42.66% | NA |
| Aus | 269 | 4.50% | 7.10% | 20.82% | 67.66% | NA |
| Indica I | 595 | 1.00% | 7.20% | 10.59% | 81.18% | NA |
| Indica II | 465 | 1.10% | 1.10% | 1.72% | 96.13% | NA |
| Indica III | 913 | 0.40% | 2.20% | 6.57% | 90.80% | NA |
| Indica Intermediate | 786 | 1.50% | 3.10% | 4.71% | 90.71% | NA |
| Temperate Japonica | 767 | 78.70% | 8.50% | 0.39% | 12.39% | NA |
| Tropical Japonica | 504 | 7.10% | 2.00% | 5.16% | 85.71% | NA |
| Japonica Intermediate | 241 | 45.20% | 2.90% | 2.90% | 48.96% | NA |
| VI/Aromatic | 96 | 9.40% | 2.10% | 2.08% | 86.46% | NA |
| Intermediate | 90 | 20.00% | 7.80% | 2.22% | 70.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1000539208 | T -> C | LOC_Os10g01840.1 | upstream_gene_variant ; 1684.0bp to feature; MODIFIER | silent_mutation | Average:8.228; most accessible tissue: Callus, score: 36.625 | N | N | N | N |
| vg1000539208 | T -> C | LOC_Os10g01830.1 | downstream_gene_variant ; 1182.0bp to feature; MODIFIER | silent_mutation | Average:8.228; most accessible tissue: Callus, score: 36.625 | N | N | N | N |
| vg1000539208 | T -> C | LOC_Os10g01830-LOC_Os10g01840 | intergenic_region ; MODIFIER | silent_mutation | Average:8.228; most accessible tissue: Callus, score: 36.625 | N | N | N | N |
| vg1000539208 | T -> DEL | N | N | silent_mutation | Average:8.228; most accessible tissue: Callus, score: 36.625 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1000539208 | 9.38E-06 | NA | mr1926 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000539208 | 1.31E-07 | NA | mr1310_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000539208 | 2.60E-06 | 9.67E-09 | mr1310_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000539208 | 4.89E-06 | NA | mr1959_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000539208 | NA | 1.34E-07 | mr1959_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000539208 | NA | 7.75E-06 | mr1968_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |