\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1000538898:

Variant ID: vg1000538898 (JBrowse)Variation Type: INDEL
Chromosome: chr10Position: 538898
Reference Allele: GAlternative Allele: A,T,GAA
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CATAACAAAAGAATAGGTTCACACCACCCGGTGACATTCCAAAATAAATGCACAGTTGAAATAAATAGAGAATTTAAATATAGGATCAACATGCTCAAAG[G/A,T,GAA]
AATTGTGTTTGGGATCTGTGTGACTTGCCTTGCAATAATGGGCTCCAATTAATCTTCTTGAATACTTACGGCGCACTCGCAAACCTTCGAAACGATGGAA

Reverse complement sequence

TTCCATCGTTTCGAAGGTTTGCGAGTGCGCCGTAAGTATTCAAGAAGATTAATTGGAGCCCATTATTGCAAGGCAAGTCACACAGATCCCAAACACAATT[C/T,A,TTC]
CTTTGAGCATGTTGATCCTATATTTAAATTCTCTATTTATTTCAACTGTGCATTTATTTTGGAATGTCACCGGGTGGTGTGAACCTATTCTTTTGTTATG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 53.60% 3.40% 10.45% 31.00% T: 1.48%; GAA: 0.04%
All Indica  2759 46.90% 3.30% 13.77% 35.01% T: 1.01%; GAA: 0.07%
All Japonica  1512 63.20% 4.60% 2.84% 29.43% NA
Aus  269 61.30% 0.00% 20.07% 4.09% T: 14.50%
Indica I  595 33.30% 5.40% 23.03% 38.32% NA
Indica II  465 40.20% 0.90% 11.61% 47.31% NA
Indica III  913 57.40% 4.50% 9.53% 27.82% T: 0.77%
Indica Intermediate  786 48.90% 1.70% 12.98% 33.59% T: 2.67%; GAA: 0.25%
Temperate Japonica  767 79.90% 8.20% 0.52% 11.34% NA
Tropical Japonica  504 41.90% 0.00% 5.16% 52.98% NA
Japonica Intermediate  241 54.40% 2.50% 5.39% 37.76% NA
VI/Aromatic  96 76.00% 0.00% 6.25% 16.67% T: 1.04%
Intermediate  90 54.40% 1.10% 12.22% 30.00% T: 2.22%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1000538898 G -> DEL N N silent_mutation Average:8.667; most accessible tissue: Callus, score: 26.503 N N N N
vg1000538898 G -> T LOC_Os10g01840.1 upstream_gene_variant ; 1994.0bp to feature; MODIFIER silent_mutation Average:8.667; most accessible tissue: Callus, score: 26.503 N N N N
vg1000538898 G -> T LOC_Os10g01830.1 downstream_gene_variant ; 872.0bp to feature; MODIFIER silent_mutation Average:8.667; most accessible tissue: Callus, score: 26.503 N N N N
vg1000538898 G -> T LOC_Os10g01830-LOC_Os10g01840 intergenic_region ; MODIFIER silent_mutation Average:8.667; most accessible tissue: Callus, score: 26.503 N N N N
vg1000538898 G -> A LOC_Os10g01840.1 upstream_gene_variant ; 1994.0bp to feature; MODIFIER silent_mutation Average:8.667; most accessible tissue: Callus, score: 26.503 N N N N
vg1000538898 G -> A LOC_Os10g01830.1 downstream_gene_variant ; 872.0bp to feature; MODIFIER silent_mutation Average:8.667; most accessible tissue: Callus, score: 26.503 N N N N
vg1000538898 G -> A LOC_Os10g01830-LOC_Os10g01840 intergenic_region ; MODIFIER silent_mutation Average:8.667; most accessible tissue: Callus, score: 26.503 N N N N
vg1000538898 G -> GAA LOC_Os10g01840.1 upstream_gene_variant ; 1993.0bp to feature; MODIFIER silent_mutation Average:8.667; most accessible tissue: Callus, score: 26.503 N N N N
vg1000538898 G -> GAA LOC_Os10g01830.1 downstream_gene_variant ; 873.0bp to feature; MODIFIER silent_mutation Average:8.667; most accessible tissue: Callus, score: 26.503 N N N N
vg1000538898 G -> GAA LOC_Os10g01830-LOC_Os10g01840 intergenic_region ; MODIFIER silent_mutation Average:8.667; most accessible tissue: Callus, score: 26.503 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1000538898 NA 8.59E-10 mr1757 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000538898 5.18E-06 NA mr1926 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000538898 5.94E-09 NA mr1310_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000538898 1.15E-09 NA mr1310_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000538898 NA 2.12E-06 mr1354_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000538898 NA 2.19E-08 mr1549_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000538898 NA 3.79E-07 mr1757_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251