\
| Variant ID: vg1000538898 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr10 | Position: 538898 |
| Reference Allele: G | Alternative Allele: A,T,GAA |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
CATAACAAAAGAATAGGTTCACACCACCCGGTGACATTCCAAAATAAATGCACAGTTGAAATAAATAGAGAATTTAAATATAGGATCAACATGCTCAAAG[G/A,T,GAA]
AATTGTGTTTGGGATCTGTGTGACTTGCCTTGCAATAATGGGCTCCAATTAATCTTCTTGAATACTTACGGCGCACTCGCAAACCTTCGAAACGATGGAA
TTCCATCGTTTCGAAGGTTTGCGAGTGCGCCGTAAGTATTCAAGAAGATTAATTGGAGCCCATTATTGCAAGGCAAGTCACACAGATCCCAAACACAATT[C/T,A,TTC]
CTTTGAGCATGTTGATCCTATATTTAAATTCTCTATTTATTTCAACTGTGCATTTATTTTGGAATGTCACCGGGTGGTGTGAACCTATTCTTTTGTTATG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 53.60% | 3.40% | 10.45% | 31.00% | T: 1.48%; GAA: 0.04% |
| All Indica | 2759 | 46.90% | 3.30% | 13.77% | 35.01% | T: 1.01%; GAA: 0.07% |
| All Japonica | 1512 | 63.20% | 4.60% | 2.84% | 29.43% | NA |
| Aus | 269 | 61.30% | 0.00% | 20.07% | 4.09% | T: 14.50% |
| Indica I | 595 | 33.30% | 5.40% | 23.03% | 38.32% | NA |
| Indica II | 465 | 40.20% | 0.90% | 11.61% | 47.31% | NA |
| Indica III | 913 | 57.40% | 4.50% | 9.53% | 27.82% | T: 0.77% |
| Indica Intermediate | 786 | 48.90% | 1.70% | 12.98% | 33.59% | T: 2.67%; GAA: 0.25% |
| Temperate Japonica | 767 | 79.90% | 8.20% | 0.52% | 11.34% | NA |
| Tropical Japonica | 504 | 41.90% | 0.00% | 5.16% | 52.98% | NA |
| Japonica Intermediate | 241 | 54.40% | 2.50% | 5.39% | 37.76% | NA |
| VI/Aromatic | 96 | 76.00% | 0.00% | 6.25% | 16.67% | T: 1.04% |
| Intermediate | 90 | 54.40% | 1.10% | 12.22% | 30.00% | T: 2.22% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1000538898 | G -> DEL | N | N | silent_mutation | Average:8.667; most accessible tissue: Callus, score: 26.503 | N | N | N | N |
| vg1000538898 | G -> T | LOC_Os10g01840.1 | upstream_gene_variant ; 1994.0bp to feature; MODIFIER | silent_mutation | Average:8.667; most accessible tissue: Callus, score: 26.503 | N | N | N | N |
| vg1000538898 | G -> T | LOC_Os10g01830.1 | downstream_gene_variant ; 872.0bp to feature; MODIFIER | silent_mutation | Average:8.667; most accessible tissue: Callus, score: 26.503 | N | N | N | N |
| vg1000538898 | G -> T | LOC_Os10g01830-LOC_Os10g01840 | intergenic_region ; MODIFIER | silent_mutation | Average:8.667; most accessible tissue: Callus, score: 26.503 | N | N | N | N |
| vg1000538898 | G -> A | LOC_Os10g01840.1 | upstream_gene_variant ; 1994.0bp to feature; MODIFIER | silent_mutation | Average:8.667; most accessible tissue: Callus, score: 26.503 | N | N | N | N |
| vg1000538898 | G -> A | LOC_Os10g01830.1 | downstream_gene_variant ; 872.0bp to feature; MODIFIER | silent_mutation | Average:8.667; most accessible tissue: Callus, score: 26.503 | N | N | N | N |
| vg1000538898 | G -> A | LOC_Os10g01830-LOC_Os10g01840 | intergenic_region ; MODIFIER | silent_mutation | Average:8.667; most accessible tissue: Callus, score: 26.503 | N | N | N | N |
| vg1000538898 | G -> GAA | LOC_Os10g01840.1 | upstream_gene_variant ; 1993.0bp to feature; MODIFIER | silent_mutation | Average:8.667; most accessible tissue: Callus, score: 26.503 | N | N | N | N |
| vg1000538898 | G -> GAA | LOC_Os10g01830.1 | downstream_gene_variant ; 873.0bp to feature; MODIFIER | silent_mutation | Average:8.667; most accessible tissue: Callus, score: 26.503 | N | N | N | N |
| vg1000538898 | G -> GAA | LOC_Os10g01830-LOC_Os10g01840 | intergenic_region ; MODIFIER | silent_mutation | Average:8.667; most accessible tissue: Callus, score: 26.503 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1000538898 | NA | 8.59E-10 | mr1757 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000538898 | 5.18E-06 | NA | mr1926 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000538898 | 5.94E-09 | NA | mr1310_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000538898 | 1.15E-09 | NA | mr1310_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000538898 | NA | 2.12E-06 | mr1354_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000538898 | NA | 2.19E-08 | mr1549_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000538898 | NA | 3.79E-07 | mr1757_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |