Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1000515513:

Variant ID: vg1000515513 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 515513
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.90, C: 0.08, others allele: 0.00, population size: 49. )

Flanking Sequence (100 bp) in Reference Genome:


ATACTGAGGCTGAGTGAGGGCTCCTCTCCTATTCCCAATCCTACGCTCCCGCGTCTTCTCAGCCTGCGAGGAGTGAAAAATCATCTTTTTCGCGTGGCTA[T/C]
GTCAAGGCGTCTCCAACCACCGCCGCTGACTCGATCTGGTCAGATCGAGCGCCCTCCGTCCAGGTCTCCACTGCTAGCATGGAGCCTCATCTCGTCGGCC

Reverse complement sequence

GGCCGACGAGATGAGGCTCCATGCTAGCAGTGGAGACCTGGACGGAGGGCGCTCGATCTGACCAGATCGAGTCAGCGGCGGTGGTTGGAGACGCCTTGAC[A/G]
TAGCCACGCGAAAAAGATGATTTTTCACTCCTCGCAGGCTGAGAAGACGCGGGAGCGTAGGATTGGGAATAGGAGAGGAGCCCTCACTCAGCCTCAGTAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 57.50% 18.50% 0.93% 23.06% NA
All Indica  2759 67.50% 0.80% 1.30% 30.45% NA
All Japonica  1512 44.80% 54.00% 0.13% 1.06% NA
Aus  269 32.00% 4.10% 1.12% 62.83% NA
Indica I  595 79.50% 1.00% 0.00% 19.50% NA
Indica II  465 53.10% 0.60% 0.00% 46.24% NA
Indica III  913 72.30% 0.20% 1.53% 25.96% NA
Indica Intermediate  786 61.20% 1.40% 2.80% 34.61% NA
Temperate Japonica  767 12.40% 87.00% 0.00% 0.65% NA
Tropical Japonica  504 92.90% 6.70% 0.00% 0.40% NA
Japonica Intermediate  241 47.70% 47.70% 0.83% 3.73% NA
VI/Aromatic  96 43.80% 9.40% 0.00% 46.88% NA
Intermediate  90 54.40% 20.00% 3.33% 22.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1000515513 T -> C LOC_Os10g01780.1 upstream_gene_variant ; 4879.0bp to feature; MODIFIER silent_mutation Average:28.436; most accessible tissue: Minghui63 young leaf, score: 36.684 N N N N
vg1000515513 T -> C LOC_Os10g01780-LOC_Os10g01790 intergenic_region ; MODIFIER silent_mutation Average:28.436; most accessible tissue: Minghui63 young leaf, score: 36.684 N N N N
vg1000515513 T -> DEL N N silent_mutation Average:28.436; most accessible tissue: Minghui63 young leaf, score: 36.684 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1000515513 1.40E-06 1.40E-06 mr1011 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000515513 NA 4.81E-08 mr1156 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000515513 NA 1.80E-08 mr1163 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000515513 NA 9.39E-07 mr1179 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000515513 NA 1.31E-06 mr1192 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000515513 NA 1.45E-06 mr1252 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000515513 1.92E-09 5.70E-26 mr1300 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000515513 2.54E-06 3.81E-10 mr1300 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000515513 7.40E-08 6.22E-35 mr1310 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000515513 2.73E-06 3.53E-12 mr1310 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000515513 NA 4.93E-12 mr1486 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000515513 NA 6.05E-11 mr1539 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000515513 NA 1.93E-08 mr1548 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000515513 NA 3.20E-10 mr1549 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000515513 NA 1.30E-07 mr1570 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000515513 NA 8.62E-10 mr1580 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000515513 NA 5.08E-07 mr1588 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000515513 NA 9.04E-09 mr1624 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000515513 2.31E-06 2.31E-06 mr1694 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000515513 NA 3.00E-07 mr1723 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000515513 NA 5.17E-07 mr1729 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000515513 NA 3.22E-07 mr1736 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000515513 NA 7.66E-06 mr1740 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000515513 NA 5.68E-12 mr1741 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000515513 NA 4.92E-09 mr1757 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000515513 NA 7.90E-07 mr1780 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000515513 NA 7.76E-10 mr1825 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000515513 NA 9.59E-07 mr1870 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000515513 NA 4.06E-06 mr1912 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000515513 1.33E-08 NA mr1926 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000515513 1.04E-06 1.40E-13 mr1926 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000515513 NA 3.01E-10 mr1959 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000515513 NA 3.39E-07 mr1959 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000515513 1.73E-12 8.87E-42 mr1310_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000515513 3.11E-07 4.77E-15 mr1310_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000515513 NA 1.71E-11 mr1486_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000515513 NA 6.04E-06 mr1588_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000515513 1.71E-07 2.48E-17 mr1959_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000515513 NA 6.62E-10 mr1959_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251