\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1000515396:

Variant ID: vg1000515396 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 515396
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GAAGAGCAGCAATGAATCTTAATTTTTGAGGATTTTACTTTAAAAAAATATGCTCCAATAGATTTCCTATTCAGATGCTAAACTTGTGGAGTTTCTATCC[T/C]
GTAATATTCGCTCTCAATACTGAGGCTGAGTGAGGGCTCCTCTCCTATTCCCAATCCTACGCTCCCGCGTCTTCTCAGCCTGCGAGGAGTGAAAAATCAT

Reverse complement sequence

ATGATTTTTCACTCCTCGCAGGCTGAGAAGACGCGGGAGCGTAGGATTGGGAATAGGAGAGGAGCCCTCACTCAGCCTCAGTATTGAGAGCGAATATTAC[A/G]
GGATAGAAACTCCACAAGTTTAGCATCTGAATAGGAAATCTATTGGAGCATATTTTTTTAAAGTAAAATCCTCAAAAATTAAGATTCATTGCTGCTCTTC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 71.80% 19.70% 2.12% 6.41% NA
All Indica  2759 93.70% 1.80% 1.23% 3.19% NA
All Japonica  1512 40.50% 54.90% 2.58% 2.05% NA
Aus  269 32.00% 8.20% 9.67% 50.19% NA
Indica I  595 95.00% 2.40% 2.69% 0.00% NA
Indica II  465 97.60% 1.50% 0.43% 0.43% NA
Indica III  913 93.00% 1.00% 0.66% 5.37% NA
Indica Intermediate  786 91.30% 2.70% 1.27% 4.71% NA
Temperate Japonica  767 12.50% 87.00% 0.39% 0.13% NA
Tropical Japonica  504 79.20% 9.30% 6.55% 4.96% NA
Japonica Intermediate  241 48.50% 48.10% 1.24% 2.07% NA
VI/Aromatic  96 46.90% 11.50% 1.04% 40.62% NA
Intermediate  90 68.90% 20.00% 0.00% 11.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1000515396 T -> C LOC_Os10g01780.1 upstream_gene_variant ; 4762.0bp to feature; MODIFIER silent_mutation Average:24.155; most accessible tissue: Minghui63 young leaf, score: 32.638 N N N N
vg1000515396 T -> C LOC_Os10g01780-LOC_Os10g01790 intergenic_region ; MODIFIER silent_mutation Average:24.155; most accessible tissue: Minghui63 young leaf, score: 32.638 N N N N
vg1000515396 T -> DEL N N silent_mutation Average:24.155; most accessible tissue: Minghui63 young leaf, score: 32.638 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1000515396 2.28E-06 2.28E-06 mr1011 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000515396 NA 2.70E-06 mr1063 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000515396 NA 5.53E-09 mr1156 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000515396 NA 4.41E-08 mr1163 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000515396 NA 3.56E-07 mr1179 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000515396 NA 1.70E-07 mr1192 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000515396 1.09E-08 1.25E-27 mr1300 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000515396 NA 6.65E-09 mr1300 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000515396 4.05E-10 9.33E-43 mr1310 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000515396 NA 1.24E-10 mr1310 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000515396 NA 1.38E-11 mr1486 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000515396 NA 3.62E-06 mr1521 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000515396 NA 1.91E-10 mr1539 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000515396 NA 5.74E-08 mr1548 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000515396 NA 4.37E-09 mr1549 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000515396 NA 9.03E-08 mr1570 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000515396 NA 1.40E-09 mr1580 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000515396 3.08E-06 6.11E-08 mr1588 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000515396 NA 1.39E-08 mr1624 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000515396 NA 7.32E-09 mr1624 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000515396 NA 5.98E-07 mr1723 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000515396 4.77E-06 4.76E-06 mr1736 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000515396 NA 1.43E-07 mr1736 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000515396 NA 8.04E-06 mr1780 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000515396 8.80E-06 5.87E-12 mr1825 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000515396 NA 1.88E-06 mr1912 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000515396 6.06E-13 1.89E-50 mr1926 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000515396 NA 8.68E-12 mr1926 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000515396 9.48E-07 6.62E-14 mr1959 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000515396 NA 1.10E-06 mr1959 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000515396 5.52E-11 2.21E-42 mr1310_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000515396 NA 3.98E-13 mr1310_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000515396 NA 3.81E-10 mr1486_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000515396 4.25E-06 2.31E-18 mr1959_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000515396 NA 1.26E-08 mr1959_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251