Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1000509880:

Variant ID: vg1000509880 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 509880
Reference Allele: A	Alternative Allele: C
Primary Allele: A	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 61. )

Flanking Sequence (100 bp) in Reference Genome:

AACATCAATGACAGGGCAGCAAGTATTTCAGAATCTGCTTTATCTACATTATCACCATCATTTTCAAATATATTTAGCCTGTTTTGTATTTCATTTTCTG[A/C]
ATCATAGATGTATAATTGAGCGAATTTCGGAGGTGAACCACGAGATCGCACAAGAGTACCAATTCGGTGGTGCACAACTCCATTGATCTTGAAAACATAA

Reverse complement sequence

TTATGTTTTCAAGATCAATGGAGTTGTGCACCACCGAATTGGTACTCTTGTGCGATCTCGTGGTTCACCTCCGAAATTCGCTCAATTATACATCTATGAT[T/G]
CAGAAAATGAAATACAAAACAGGCTAAATATATTTGAAAATGATGGTGATAATGTAGATAAAGCAGATTCTGAAATACTTGCTGCCCTGTCATTGATGTT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	10.60%	7.00%	29.41%	53.05%	NA
All Indica	2759	1.00%	0.10%	37.51%	61.40%	NA
All Japonica	1512	30.40%	20.20%	8.27%	41.14%	NA
Aus	269	0.70%	3.00%	64.68%	31.60%	NA
Indica I	595	0.80%	0.20%	35.29%	63.70%	NA
Indica II	465	2.40%	0.00%	24.73%	72.90%	NA
Indica III	913	0.40%	0.00%	46.99%	52.57%	NA
Indica Intermediate	786	0.90%	0.30%	35.75%	63.10%	NA
Temperate Japonica	767	55.80%	25.30%	7.95%	10.95%	NA
Tropical Japonica	504	2.00%	5.20%	5.16%	87.70%	NA
Japonica Intermediate	241	9.10%	35.30%	15.77%	39.83%	NA
VI/Aromatic	96	0.00%	9.40%	34.38%	56.25%	NA
Intermediate	90	12.20%	4.40%	25.56%	57.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1000509880	A -> C	LOC_Os10g01780.1	missense_variant ; p.Ser174Ala; MODERATE	nonsynonymous_codon ; S174A	Average:17.788; most accessible tissue: Callus, score: 28.281	benign	-0.888	TOLERATED	0.06
vg1000509880	A -> DEL	LOC_Os10g01780.1	N	frameshift_variant	Average:17.788; most accessible tissue: Callus, score: 28.281	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1000509880	NA	2.18E-06	mr1010	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000509880	NA	3.84E-07	mr1026	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000509880	NA	4.08E-06	mr1063	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000509880	4.99E-06	6.61E-29	mr1137	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000509880	NA	2.09E-12	mr1137	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000509880	NA	9.82E-06	mr1161	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000509880	NA	6.98E-07	mr1164	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000509880	NA	8.07E-08	mr1183	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000509880	NA	4.87E-06	mr1202	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000509880	6.11E-06	6.11E-06	mr1261	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000509880	1.05E-06	NA	mr1300	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000509880	1.24E-08	NA	mr1310	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000509880	NA	2.51E-07	mr1310	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000509880	NA	8.83E-08	mr1503	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000509880	NA	2.59E-07	mr1548	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000509880	4.07E-07	1.21E-27	mr1617	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000509880	NA	4.59E-13	mr1617	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000509880	NA	1.05E-06	mr1627	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000509880	NA	1.77E-06	mr1748	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000509880	NA	2.15E-06	mr1880	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000509880	7.70E-13	NA	mr1926	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000509880	NA	8.27E-09	mr1926	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000509880	NA	1.50E-11	mr1959	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000509880	NA	1.37E-07	mr1977	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000509880	NA	4.20E-06	mr1977	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000509880	NA	9.41E-11	mr1137_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000509880	NA	7.86E-06	mr1161_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000509880	8.38E-12	2.15E-31	mr1310_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000509880	NA	2.93E-09	mr1310_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000509880	NA	2.06E-08	mr1617_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000509880	1.40E-07	1.69E-17	mr1959_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000509880	NA	4.95E-07	mr1959_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251