\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1000509880:

Variant ID: vg1000509880 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 509880
Reference Allele: AAlternative Allele: C
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 61. )

Flanking Sequence (100 bp) in Reference Genome:


AACATCAATGACAGGGCAGCAAGTATTTCAGAATCTGCTTTATCTACATTATCACCATCATTTTCAAATATATTTAGCCTGTTTTGTATTTCATTTTCTG[A/C]
ATCATAGATGTATAATTGAGCGAATTTCGGAGGTGAACCACGAGATCGCACAAGAGTACCAATTCGGTGGTGCACAACTCCATTGATCTTGAAAACATAA

Reverse complement sequence

TTATGTTTTCAAGATCAATGGAGTTGTGCACCACCGAATTGGTACTCTTGTGCGATCTCGTGGTTCACCTCCGAAATTCGCTCAATTATACATCTATGAT[T/G]
CAGAAAATGAAATACAAAACAGGCTAAATATATTTGAAAATGATGGTGATAATGTAGATAAAGCAGATTCTGAAATACTTGCTGCCCTGTCATTGATGTT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 10.60% 7.00% 29.41% 53.05% NA
All Indica  2759 1.00% 0.10% 37.51% 61.40% NA
All Japonica  1512 30.40% 20.20% 8.27% 41.14% NA
Aus  269 0.70% 3.00% 64.68% 31.60% NA
Indica I  595 0.80% 0.20% 35.29% 63.70% NA
Indica II  465 2.40% 0.00% 24.73% 72.90% NA
Indica III  913 0.40% 0.00% 46.99% 52.57% NA
Indica Intermediate  786 0.90% 0.30% 35.75% 63.10% NA
Temperate Japonica  767 55.80% 25.30% 7.95% 10.95% NA
Tropical Japonica  504 2.00% 5.20% 5.16% 87.70% NA
Japonica Intermediate  241 9.10% 35.30% 15.77% 39.83% NA
VI/Aromatic  96 0.00% 9.40% 34.38% 56.25% NA
Intermediate  90 12.20% 4.40% 25.56% 57.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1000509880 A -> C LOC_Os10g01780.1 missense_variant ; p.Ser174Ala; MODERATE nonsynonymous_codon ; S174A Average:17.788; most accessible tissue: Callus, score: 28.281 benign -0.888 TOLERATED 0.06
vg1000509880 A -> DEL LOC_Os10g01780.1 N frameshift_variant Average:17.788; most accessible tissue: Callus, score: 28.281 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1000509880 NA 2.18E-06 mr1010 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000509880 NA 3.84E-07 mr1026 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000509880 NA 4.08E-06 mr1063 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000509880 4.99E-06 6.61E-29 mr1137 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000509880 NA 2.09E-12 mr1137 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000509880 NA 9.82E-06 mr1161 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000509880 NA 6.98E-07 mr1164 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000509880 NA 8.07E-08 mr1183 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000509880 NA 4.87E-06 mr1202 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000509880 6.11E-06 6.11E-06 mr1261 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000509880 1.05E-06 NA mr1300 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000509880 1.24E-08 NA mr1310 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000509880 NA 2.51E-07 mr1310 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000509880 NA 8.83E-08 mr1503 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000509880 NA 2.59E-07 mr1548 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000509880 4.07E-07 1.21E-27 mr1617 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000509880 NA 4.59E-13 mr1617 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000509880 NA 1.05E-06 mr1627 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000509880 NA 1.77E-06 mr1748 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000509880 NA 2.15E-06 mr1880 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000509880 7.70E-13 NA mr1926 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000509880 NA 8.27E-09 mr1926 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000509880 NA 1.50E-11 mr1959 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000509880 NA 1.37E-07 mr1977 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000509880 NA 4.20E-06 mr1977 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000509880 NA 9.41E-11 mr1137_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000509880 NA 7.86E-06 mr1161_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000509880 8.38E-12 2.15E-31 mr1310_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000509880 NA 2.93E-09 mr1310_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000509880 NA 2.06E-08 mr1617_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000509880 1.40E-07 1.69E-17 mr1959_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000509880 NA 4.95E-07 mr1959_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251