| Variant ID: vg1000493003 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr10 | Position: 493003 |
| Reference Allele: G | Alternative Allele: A,GA |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
CACCATATATAATACTCCCTCCGTATTTTAATGTATGACGCCGTTGACTATTCGACCAACGTTTGACCATTTGTTTTATTCAAAATTTTTATGCAAATAT[G/A,GA]
AAAATATTTATGTTATGCTTAAAGAACATTTGATGACGAATCAAGTTATAATAAAATAAATGATAATTACATAAATTTTTTGAATAAGACGAATGGTCAA
TTGACCATTCGTCTTATTCAAAAAATTTATGTAATTATCATTTATTTTATTATAACTTGATTCGTCATCAAATGTTCTTTAAGCATAACATAAATATTTT[C/T,TC]
ATATTTGCATAAAAATTTTGAATAAAACAAATGGTCAAACGTTGGTCGAATAGTCAACGGCGTCATACATTAAAATACGGAGGGAGTATTATATATGGTG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 88.00% | 5.10% | 0.76% | 6.12% | GA: 0.06% |
| All Indica | 2759 | 95.70% | 0.70% | 0.40% | 3.23% | GA: 0.04% |
| All Japonica | 1512 | 93.50% | 6.00% | 0.00% | 0.53% | NA |
| Aus | 269 | 6.70% | 31.20% | 8.18% | 53.53% | GA: 0.37% |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.10% | 0.20% | 0.00% | 0.65% | NA |
| Indica III | 913 | 93.80% | 0.20% | 0.55% | 5.48% | NA |
| Indica Intermediate | 786 | 92.60% | 1.90% | 0.76% | 4.58% | GA: 0.13% |
| Temperate Japonica | 767 | 91.40% | 8.50% | 0.00% | 0.13% | NA |
| Tropical Japonica | 504 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 87.60% | 9.50% | 0.00% | 2.90% | NA |
| VI/Aromatic | 96 | 15.60% | 41.70% | 2.08% | 40.62% | NA |
| Intermediate | 90 | 80.00% | 7.80% | 1.11% | 10.00% | GA: 1.11% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1000493003 | G -> GA | LOC_Os10g01760.1 | upstream_gene_variant ; 3532.0bp to feature; MODIFIER | silent_mutation | Average:45.078; most accessible tissue: Minghui63 root, score: 68.289 | N | N | N | N |
| vg1000493003 | G -> GA | LOC_Os10g01760-LOC_Os10g01770 | intergenic_region ; MODIFIER | silent_mutation | Average:45.078; most accessible tissue: Minghui63 root, score: 68.289 | N | N | N | N |
| vg1000493003 | G -> A | LOC_Os10g01760.1 | upstream_gene_variant ; 3531.0bp to feature; MODIFIER | silent_mutation | Average:45.078; most accessible tissue: Minghui63 root, score: 68.289 | N | N | N | N |
| vg1000493003 | G -> A | LOC_Os10g01760-LOC_Os10g01770 | intergenic_region ; MODIFIER | silent_mutation | Average:45.078; most accessible tissue: Minghui63 root, score: 68.289 | N | N | N | N |
| vg1000493003 | G -> DEL | N | N | silent_mutation | Average:45.078; most accessible tissue: Minghui63 root, score: 68.289 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1000493003 | NA | 1.41E-07 | mr1040 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000493003 | 1.55E-07 | NA | mr1310 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000493003 | 2.01E-06 | NA | mr1549 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000493003 | NA | 2.47E-08 | mr1549 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000493003 | NA | 2.92E-06 | mr1550 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000493003 | 1.64E-09 | NA | mr1757 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000493003 | 6.66E-07 | 1.48E-11 | mr1757 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000493003 | 2.00E-08 | NA | mr1926 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000493003 | NA | 2.38E-07 | mr1968 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000493003 | 5.57E-13 | NA | mr1310_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/