\
| Variant ID: vg1000491820 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 491820 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TCATGCTATGTTAAAATAATTTTACTATATGATTTAACTAAGTATATTTATATTTATGAAGTAATATATTTTGTCTTTATTTCGTAAAAAGTCATACTAT[G/A]
AATGCACACACACACATACCTACGACTATTTCCGAAAGACTGGGCCGGCATATTTTGAGATTAAAGAAATCACCACGGATGCCTCACTATTGATGGGTAC
GTACCCATCAATAGTGAGGCATCCGTGGTGATTTCTTTAATCTCAAAATATGCCGGCCCAGTCTTTCGGAAATAGTCGTAGGTATGTGTGTGTGTGCATT[C/T]
ATAGTATGACTTTTTACGAAATAAAGACAAAATATATTACTTCATAAATATAAATATACTTAGTTAAATCATATAGTAAAATTATTTTAACATAGCATGA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 85.10% | 0.50% | 11.26% | 3.17% | NA |
| All Indica | 2759 | 75.90% | 0.80% | 17.87% | 5.44% | NA |
| All Japonica | 1512 | 99.50% | 0.00% | 0.46% | 0.00% | NA |
| Aus | 269 | 89.20% | 0.00% | 10.78% | 0.00% | NA |
| Indica I | 595 | 57.30% | 0.30% | 30.76% | 11.60% | NA |
| Indica II | 465 | 95.10% | 0.20% | 3.66% | 1.08% | NA |
| Indica III | 913 | 75.80% | 1.60% | 19.17% | 3.40% | NA |
| Indica Intermediate | 786 | 78.80% | 0.50% | 15.01% | 5.73% | NA |
| Temperate Japonica | 767 | 99.90% | 0.00% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 98.80% | 0.00% | 1.19% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 0.00% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 97.80% | 0.00% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1000491820 | G -> A | LOC_Os10g01750.1 | upstream_gene_variant ; 4156.0bp to feature; MODIFIER | silent_mutation | Average:28.505; most accessible tissue: Minghui63 panicle, score: 42.799 | N | N | N | N |
| vg1000491820 | G -> A | LOC_Os10g01760.1 | upstream_gene_variant ; 2348.0bp to feature; MODIFIER | silent_mutation | Average:28.505; most accessible tissue: Minghui63 panicle, score: 42.799 | N | N | N | N |
| vg1000491820 | G -> A | LOC_Os10g01760-LOC_Os10g01770 | intergenic_region ; MODIFIER | silent_mutation | Average:28.505; most accessible tissue: Minghui63 panicle, score: 42.799 | N | N | N | N |
| vg1000491820 | G -> DEL | N | N | silent_mutation | Average:28.505; most accessible tissue: Minghui63 panicle, score: 42.799 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1000491820 | 8.60E-06 | 1.21E-06 | mr1278_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000491820 | 4.02E-06 | 4.02E-06 | mr1337_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000491820 | 4.70E-06 | 4.70E-06 | mr1374_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000491820 | NA | 9.89E-06 | mr1745_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000491820 | 5.79E-06 | 5.79E-06 | mr1812_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000491820 | 4.56E-06 | 4.56E-06 | mr1832_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000491820 | 7.34E-06 | 7.34E-06 | mr1833_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000491820 | 2.26E-06 | 2.26E-06 | mr1843_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000491820 | 3.90E-06 | 3.90E-06 | mr1847_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |