\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1000491820:

Variant ID: vg1000491820 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 491820
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCATGCTATGTTAAAATAATTTTACTATATGATTTAACTAAGTATATTTATATTTATGAAGTAATATATTTTGTCTTTATTTCGTAAAAAGTCATACTAT[G/A]
AATGCACACACACACATACCTACGACTATTTCCGAAAGACTGGGCCGGCATATTTTGAGATTAAAGAAATCACCACGGATGCCTCACTATTGATGGGTAC

Reverse complement sequence

GTACCCATCAATAGTGAGGCATCCGTGGTGATTTCTTTAATCTCAAAATATGCCGGCCCAGTCTTTCGGAAATAGTCGTAGGTATGTGTGTGTGTGCATT[C/T]
ATAGTATGACTTTTTACGAAATAAAGACAAAATATATTACTTCATAAATATAAATATACTTAGTTAAATCATATAGTAAAATTATTTTAACATAGCATGA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 85.10% 0.50% 11.26% 3.17% NA
All Indica  2759 75.90% 0.80% 17.87% 5.44% NA
All Japonica  1512 99.50% 0.00% 0.46% 0.00% NA
Aus  269 89.20% 0.00% 10.78% 0.00% NA
Indica I  595 57.30% 0.30% 30.76% 11.60% NA
Indica II  465 95.10% 0.20% 3.66% 1.08% NA
Indica III  913 75.80% 1.60% 19.17% 3.40% NA
Indica Intermediate  786 78.80% 0.50% 15.01% 5.73% NA
Temperate Japonica  767 99.90% 0.00% 0.13% 0.00% NA
Tropical Japonica  504 98.80% 0.00% 1.19% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 0.00% 1.04% 0.00% NA
Intermediate  90 97.80% 0.00% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1000491820 G -> A LOC_Os10g01750.1 upstream_gene_variant ; 4156.0bp to feature; MODIFIER silent_mutation Average:28.505; most accessible tissue: Minghui63 panicle, score: 42.799 N N N N
vg1000491820 G -> A LOC_Os10g01760.1 upstream_gene_variant ; 2348.0bp to feature; MODIFIER silent_mutation Average:28.505; most accessible tissue: Minghui63 panicle, score: 42.799 N N N N
vg1000491820 G -> A LOC_Os10g01760-LOC_Os10g01770 intergenic_region ; MODIFIER silent_mutation Average:28.505; most accessible tissue: Minghui63 panicle, score: 42.799 N N N N
vg1000491820 G -> DEL N N silent_mutation Average:28.505; most accessible tissue: Minghui63 panicle, score: 42.799 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1000491820 8.60E-06 1.21E-06 mr1278_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000491820 4.02E-06 4.02E-06 mr1337_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000491820 4.70E-06 4.70E-06 mr1374_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000491820 NA 9.89E-06 mr1745_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000491820 5.79E-06 5.79E-06 mr1812_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000491820 4.56E-06 4.56E-06 mr1832_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000491820 7.34E-06 7.34E-06 mr1833_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000491820 2.26E-06 2.26E-06 mr1843_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1000491820 3.90E-06 3.90E-06 mr1847_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251