\
| Variant ID: vg1000480049 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 480049 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
ATTTTTCAAAGTAGTTTTTAACTTTTAGGAGTAGCGTTTACACTTTCGGAGGCATTGTGAAATGGTATATTTGCAAACGAAAAGTAATTGTGAATAAAAA[T/A]
TTTATATACGTGTCTTTAGCGATCTAAAAGTAAAGGCTGAAAAATAAACTTCGATGAAAAATCCTTAAAATCAACTCCAAATGTAAGGTTAAAATTTAAA
TTTAAATTTTAACCTTACATTTGGAGTTGATTTTAAGGATTTTTCATCGAAGTTTATTTTTCAGCCTTTACTTTTAGATCGCTAAAGACACGTATATAAA[A/T]
TTTTTATTCACAATTACTTTTCGTTTGCAAATATACCATTTCACAATGCCTCCGAAAGTGTAAACGCTACTCCTAAAAGTTAAAAACTACTTTGAAAAAT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 98.20% | 0.80% | 0.30% | 0.72% | NA |
| All Indica | 2759 | 99.80% | 0.00% | 0.00% | 0.22% | NA |
| All Japonica | 1512 | 96.80% | 2.40% | 0.86% | 0.00% | NA |
| Aus | 269 | 89.20% | 0.00% | 0.37% | 10.41% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.20% | 0.00% | 0.00% | 0.76% | NA |
| Temperate Japonica | 767 | 94.40% | 4.20% | 1.43% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 97.50% | 1.70% | 0.83% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1000480049 | T -> A | LOC_Os10g01740.1 | upstream_gene_variant ; 2217.0bp to feature; MODIFIER | silent_mutation | Average:38.497; most accessible tissue: Callus, score: 71.455 | N | N | N | N |
| vg1000480049 | T -> A | LOC_Os10g01730.1 | downstream_gene_variant ; 3995.0bp to feature; MODIFIER | silent_mutation | Average:38.497; most accessible tissue: Callus, score: 71.455 | N | N | N | N |
| vg1000480049 | T -> A | LOC_Os10g01750.1 | downstream_gene_variant ; 2635.0bp to feature; MODIFIER | silent_mutation | Average:38.497; most accessible tissue: Callus, score: 71.455 | N | N | N | N |
| vg1000480049 | T -> A | LOC_Os10g01740-LOC_Os10g01750 | intergenic_region ; MODIFIER | silent_mutation | Average:38.497; most accessible tissue: Callus, score: 71.455 | N | N | N | N |
| vg1000480049 | T -> DEL | N | N | silent_mutation | Average:38.497; most accessible tissue: Callus, score: 71.455 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1000480049 | 8.08E-07 | 2.19E-10 | mr1757 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000480049 | 6.32E-07 | 6.97E-10 | mr1549_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000480049 | 9.43E-06 | 3.48E-07 | mr1550_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1000480049 | 8.32E-06 | 9.86E-09 | mr1757_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |